Mutagenetix > Incidental Mutation

Incidental Mutation 'R6662:Slco1a6'

528019

Institutional Source

Beutler Lab

Gene Symbol

Slco1a6

Ensembl Gene

ENSMUSG00000079262

Gene Name

solute carrier organic anion transporter family, member 1a6

Synonyms

Slc21a13, organic anion-transporting polypeptide, 4930422F19Rik, Oatp-5

MMRRC Submission

044782-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R6662 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

142085761-142208521 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 142133215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 118 (T118I)

Ref Sequence

ENSEMBL: ENSMUSP00000107458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111827]

AlphaFold

Q99J94

Predicted Effect

probably damaging
Transcript: ENSMUST00000111827
AA Change: T118I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000107458
Gene: ENSMUSG00000079262
AA Change: T118I

Domain	Start	End	E-Value	Type
Pfam:MFS_1	21	421	7.8e-26	PFAM
Pfam:OATP	21	597	1.3e-163	PFAM
Pfam:Kazal_2	445	486	2.7e-11	PFAM
transmembrane domain	600	619	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172984

Meta Mutation Damage Score

0.1622

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (46/46)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox1	A	G	11: 116,175,323	Y418H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Aldh3a1	G	A	11: 61,214,655	V196I	probably benign	Het
Aox3	A	G	1: 58,118,615	K44E	probably damaging	Het
Bad	T	A	19: 6,951,070		probably benign	Het
BC034090	G	T	1: 155,226,339	Q60K	possibly damaging	Het
Casp6	A	G	3: 129,912,226	T181A	probably benign	Het
Catsperg2	G	A	7: 29,719,513		probably benign	Het
Ccdc14	T	C	16: 34,690,794	L46P	probably damaging	Het
Ces1b	A	G	8: 93,064,069	L364S	probably benign	Het
Cfap45	T	C	1: 172,529,850	I15T	probably benign	Het
D730048I06Rik	C	A	9: 35,790,000	R6M	possibly damaging	Het
Dph5	G	A	3: 115,928,556	E228K	probably benign	Het
Fat4	G	T	3: 38,956,821	L2023F	possibly damaging	Het
Garem1	T	C	18: 21,148,247	N351D	probably benign	Het
Gm14124	G	A	2: 150,266,252		probably null	Het
Grm2	C	T	9: 106,648,053	A488T	probably benign	Het
Ifit3b	A	G	19: 34,611,937	E171G	probably damaging	Het
Il1rn	A	T	2: 24,336,875		probably null	Het
Itih5	A	T	2: 10,249,181	I748F	probably benign	Het
Kcnh5	C	A	12: 75,007,611	D520Y	probably damaging	Het
Mgat5	C	A	1: 127,469,237	H574N	probably damaging	Het
Moxd1	A	C	10: 24,284,760	D437A	probably damaging	Het
Mybpc2	A	G	7: 44,506,166	F888L	probably benign	Het
Ncs1	T	A	2: 31,287,360	L183Q	probably damaging	Het
Neto2	A	T	8: 85,663,215	D206E	probably damaging	Het
Omp	A	G	7: 98,145,339	L27P	probably damaging	Het
Oxsm	A	G	14: 16,242,287	S161P	probably benign	Het
Pde4b	A	G	4: 102,601,898	I381M	possibly damaging	Het
Pramel5	A	T	4: 144,273,105	N137K	probably benign	Het
Prss33	T	C	17: 23,833,960	S247G	probably damaging	Het
Rassf9	T	A	10: 102,546,038	L425Q	possibly damaging	Het
Setx	A	T	2: 29,158,114	D1909V	probably damaging	Het
Slc26a3	A	T	12: 31,457,346	K402*	probably null	Het
Syne1	A	G	10: 5,128,416	L6769P	probably damaging	Het
Tas2r107	A	T	6: 131,659,489	V199D	possibly damaging	Het
Tchp	A	G	5: 114,720,015		probably null	Het
Trdn	A	T	10: 33,474,487	N684I	probably damaging	Het
Trio	G	T	15: 27,854,996	T700K	probably benign	Het
Ttn	C	T	2: 76,755,898	V20084I	probably benign	Het
Ubl3	A	T	5: 148,509,306	Y62*	probably null	Het
Uckl1	A	G	2: 181,573,260	Y267H	possibly damaging	Het
Zfp786	T	C	6: 47,826,986	N41D	probably damaging	Het
Zfp983	T	C	17: 21,662,085	S310P	probably damaging	Het

Other mutations in Slco1a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Slco1a6	APN	6	142161017	missense	probably benign	0.00
IGL00430:Slco1a6	APN	6	142101651	nonsense	probably null
IGL00541:Slco1a6	APN	6	142096299	missense	possibly damaging	0.67
IGL01340:Slco1a6	APN	6	142109383	missense	possibly damaging	0.71
IGL01693:Slco1a6	APN	6	142133209	nonsense	probably null
IGL01713:Slco1a6	APN	6	142086567	missense	possibly damaging	0.87
IGL01828:Slco1a6	APN	6	142096411	missense	probably damaging	1.00
IGL02049:Slco1a6	APN	6	142101583	splice site	probably benign
IGL02085:Slco1a6	APN	6	142086474	missense	probably benign	0.00
IGL02245:Slco1a6	APN	6	142109424	missense	probably damaging	1.00
IGL02549:Slco1a6	APN	6	142096415	splice site	probably benign
IGL02698:Slco1a6	APN	6	142103011	nonsense	probably null
IGL02948:Slco1a6	APN	6	142133235	splice site	probably null
IGL03075:Slco1a6	APN	6	142103149	splice site	probably benign
PIT4585001:Slco1a6	UTSW	6	142109520	missense	probably damaging	0.99
R0008:Slco1a6	UTSW	6	142157222	unclassified	probably benign
R0106:Slco1a6	UTSW	6	142157390	unclassified	probably benign
R0106:Slco1a6	UTSW	6	142157390	unclassified	probably benign
R0173:Slco1a6	UTSW	6	142103122	missense	probably benign	0.10
R1642:Slco1a6	UTSW	6	142086434	missense	probably benign	0.00
R1939:Slco1a6	UTSW	6	142133230	missense	probably damaging	1.00
R2256:Slco1a6	UTSW	6	142091016	missense	probably benign	0.04
R2257:Slco1a6	UTSW	6	142091016	missense	probably benign	0.04
R2696:Slco1a6	UTSW	6	142112936	missense	probably damaging	1.00
R2902:Slco1a6	UTSW	6	142096320	missense	probably damaging	1.00
R4602:Slco1a6	UTSW	6	142101652	missense	probably benign	0.00
R4611:Slco1a6	UTSW	6	142101652	missense	probably benign	0.00
R4958:Slco1a6	UTSW	6	142145705	missense	probably damaging	1.00
R5256:Slco1a6	UTSW	6	142132701	missense	probably benign	0.39
R5347:Slco1a6	UTSW	6	142086599	missense	probably damaging	0.98
R6130:Slco1a6	UTSW	6	142086429	missense	probably benign	0.26
R6384:Slco1a6	UTSW	6	142109379	missense	probably benign	0.01
R6543:Slco1a6	UTSW	6	142133146	missense	probably benign	0.00
R6687:Slco1a6	UTSW	6	142099350	missense	possibly damaging	0.91
R6702:Slco1a6	UTSW	6	142103100	missense	probably damaging	0.99
R7012:Slco1a6	UTSW	6	142086561	missense	probably benign	0.02
R7140:Slco1a6	UTSW	6	142103019	missense	probably benign	0.00
R7392:Slco1a6	UTSW	6	142157277	missense	probably benign	0.00
R7399:Slco1a6	UTSW	6	142091068	missense	probably benign	0.01
R7476:Slco1a6	UTSW	6	142103001	missense	possibly damaging	0.71
R7621:Slco1a6	UTSW	6	142161017	missense	probably damaging	0.96
R7633:Slco1a6	UTSW	6	142145755	missense	probably damaging	1.00
R8139:Slco1a6	UTSW	6	142089900	missense	probably damaging	1.00
R8177:Slco1a6	UTSW	6	142101734	missense	probably damaging	1.00
R8768:Slco1a6	UTSW	6	142133171	missense	probably benign	0.01
R8957:Slco1a6	UTSW	6	142145767	missense	probably damaging	0.99
R9090:Slco1a6	UTSW	6	142089849	missense	probably damaging	1.00
R9271:Slco1a6	UTSW	6	142089849	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCCAGTGTGGTATTATAACCTTTC -3'
(R):5'- CTACATGTTCAGCCCAATGATAC -3'

Sequencing Primer
(F):5'- CCTTTCATAAAAGAGCATTCTGTAGC -3'
(R):5'- GTGCAGCAAGTACTTCACATG -3'

Posted On

2018-07-24