Incidental Mutation 'R6662:Slco1a6'
ID 528019
Institutional Source Beutler Lab
Gene Symbol Slco1a6
Ensembl Gene ENSMUSG00000079262
Gene Name solute carrier organic anion transporter family, member 1a6
Synonyms Slc21a13, organic anion-transporting polypeptide, 4930422F19Rik, Oatp-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 142085761-142208521 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 142133215 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 118 (T118I)
Ref Sequence ENSEMBL: ENSMUSP00000107458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111827]
AlphaFold Q99J94
Predicted Effect probably damaging
Transcript: ENSMUST00000111827
AA Change: T118I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107458
Gene: ENSMUSG00000079262
AA Change: T118I

DomainStartEndE-ValueType
Pfam:MFS_1 21 421 7.8e-26 PFAM
Pfam:OATP 21 597 1.3e-163 PFAM
Pfam:Kazal_2 445 486 2.7e-11 PFAM
transmembrane domain 600 619 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172984
Meta Mutation Damage Score 0.1622 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Slco1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Slco1a6 APN 6 142161017 missense probably benign 0.00
IGL00430:Slco1a6 APN 6 142101651 nonsense probably null
IGL00541:Slco1a6 APN 6 142096299 missense possibly damaging 0.67
IGL01340:Slco1a6 APN 6 142109383 missense possibly damaging 0.71
IGL01693:Slco1a6 APN 6 142133209 nonsense probably null
IGL01713:Slco1a6 APN 6 142086567 missense possibly damaging 0.87
IGL01828:Slco1a6 APN 6 142096411 missense probably damaging 1.00
IGL02049:Slco1a6 APN 6 142101583 splice site probably benign
IGL02085:Slco1a6 APN 6 142086474 missense probably benign 0.00
IGL02245:Slco1a6 APN 6 142109424 missense probably damaging 1.00
IGL02549:Slco1a6 APN 6 142096415 splice site probably benign
IGL02698:Slco1a6 APN 6 142103011 nonsense probably null
IGL02948:Slco1a6 APN 6 142133235 splice site probably null
IGL03075:Slco1a6 APN 6 142103149 splice site probably benign
PIT4585001:Slco1a6 UTSW 6 142109520 missense probably damaging 0.99
R0008:Slco1a6 UTSW 6 142157222 unclassified probably benign
R0106:Slco1a6 UTSW 6 142157390 unclassified probably benign
R0106:Slco1a6 UTSW 6 142157390 unclassified probably benign
R0173:Slco1a6 UTSW 6 142103122 missense probably benign 0.10
R1642:Slco1a6 UTSW 6 142086434 missense probably benign 0.00
R1939:Slco1a6 UTSW 6 142133230 missense probably damaging 1.00
R2256:Slco1a6 UTSW 6 142091016 missense probably benign 0.04
R2257:Slco1a6 UTSW 6 142091016 missense probably benign 0.04
R2696:Slco1a6 UTSW 6 142112936 missense probably damaging 1.00
R2902:Slco1a6 UTSW 6 142096320 missense probably damaging 1.00
R4602:Slco1a6 UTSW 6 142101652 missense probably benign 0.00
R4611:Slco1a6 UTSW 6 142101652 missense probably benign 0.00
R4958:Slco1a6 UTSW 6 142145705 missense probably damaging 1.00
R5256:Slco1a6 UTSW 6 142132701 missense probably benign 0.39
R5347:Slco1a6 UTSW 6 142086599 missense probably damaging 0.98
R6130:Slco1a6 UTSW 6 142086429 missense probably benign 0.26
R6384:Slco1a6 UTSW 6 142109379 missense probably benign 0.01
R6543:Slco1a6 UTSW 6 142133146 missense probably benign 0.00
R6687:Slco1a6 UTSW 6 142099350 missense possibly damaging 0.91
R6702:Slco1a6 UTSW 6 142103100 missense probably damaging 0.99
R7012:Slco1a6 UTSW 6 142086561 missense probably benign 0.02
R7140:Slco1a6 UTSW 6 142103019 missense probably benign 0.00
R7392:Slco1a6 UTSW 6 142157277 missense probably benign 0.00
R7399:Slco1a6 UTSW 6 142091068 missense probably benign 0.01
R7476:Slco1a6 UTSW 6 142103001 missense possibly damaging 0.71
R7621:Slco1a6 UTSW 6 142161017 missense probably damaging 0.96
R7633:Slco1a6 UTSW 6 142145755 missense probably damaging 1.00
R8139:Slco1a6 UTSW 6 142089900 missense probably damaging 1.00
R8177:Slco1a6 UTSW 6 142101734 missense probably damaging 1.00
R8768:Slco1a6 UTSW 6 142133171 missense probably benign 0.01
R8957:Slco1a6 UTSW 6 142145767 missense probably damaging 0.99
R9090:Slco1a6 UTSW 6 142089849 missense probably damaging 1.00
R9271:Slco1a6 UTSW 6 142089849 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGTGTGGTATTATAACCTTTC -3'
(R):5'- CTACATGTTCAGCCCAATGATAC -3'

Sequencing Primer
(F):5'- CCTTTCATAAAAGAGCATTCTGTAGC -3'
(R):5'- GTGCAGCAAGTACTTCACATG -3'
Posted On 2018-07-24