Mutagenetix > Incidental Mutation

Incidental Mutation 'R6662:Mybpc2'

528020

Institutional Source

Beutler Lab

Gene Symbol

Mybpc2

Ensembl Gene

ENSMUSG00000038670

Gene Name

myosin binding protein C, fast-type

Synonyms

Fast-type C-protein

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6662 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44501699-44524656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44506166 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 888 (F888L)

Ref Sequence

ENSEMBL: ENSMUSP00000130127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165208]

AlphaFold

Q5XKE0

PDB Structure

Solution structure of the fibronectin type-III domain of mouse myosin-binding protein C, Fast-type homolog [SOLUTION NMR]
Solution structure of the Ig-like domain(433- 525) of murine myosin-binding protein C, fast-type [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000165208
AA Change: F888L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670
AA Change: F888L

Domain	Start	End	E-Value	Type
low complexity region	2	37	N/A	INTRINSIC
IG	54	150	6.26e-5	SMART
PDB:2LHU\|A	160	236	7e-9	PDB
low complexity region	237	252	N/A	INTRINSIC
IG	258	337	5.21e-2	SMART
IG	347	430	1.2e-1	SMART
IG	440	526	2.72e-5	SMART
IG	546	631	1.68e-5	SMART
FN3	634	717	3.29e-11	SMART
FN3	732	815	1.23e-10	SMART
IG	842	925	6.07e-3	SMART
FN3	928	1010	2.08e-8	SMART
IGc2	1055	1122	6.91e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205847

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207290

Predicted Effect

probably benign
Transcript: ENSMUST00000207516

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. This family includes the fast-, slow- and cardiac-type isoforms, each of which is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The protein encoded by this locus is referred to as the fast-type isoform. Mutations in the related but distinct genes encoding the slow-type and cardiac-type isoforms have been associated with distal arthrogryposis, type 1 and hypertrophic cardiomyopathy, respectively. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox1	A	G	11: 116,175,323	Y418H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Aldh3a1	G	A	11: 61,214,655	V196I	probably benign	Het
Aox3	A	G	1: 58,118,615	K44E	probably damaging	Het
Bad	T	A	19: 6,951,070		probably benign	Het
BC034090	G	T	1: 155,226,339	Q60K	possibly damaging	Het
Casp6	A	G	3: 129,912,226	T181A	probably benign	Het
Catsperg2	G	A	7: 29,719,513		probably benign	Het
Ccdc14	T	C	16: 34,690,794	L46P	probably damaging	Het
Ces1b	A	G	8: 93,064,069	L364S	probably benign	Het
Cfap45	T	C	1: 172,529,850	I15T	probably benign	Het
D730048I06Rik	C	A	9: 35,790,000	R6M	possibly damaging	Het
Dph5	G	A	3: 115,928,556	E228K	probably benign	Het
Fat4	G	T	3: 38,956,821	L2023F	possibly damaging	Het
Garem1	T	C	18: 21,148,247	N351D	probably benign	Het
Gm14124	G	A	2: 150,266,252		probably null	Het
Grm2	C	T	9: 106,648,053	A488T	probably benign	Het
Ifit3b	A	G	19: 34,611,937	E171G	probably damaging	Het
Il1rn	A	T	2: 24,336,875		probably null	Het
Itih5	A	T	2: 10,249,181	I748F	probably benign	Het
Kcnh5	C	A	12: 75,007,611	D520Y	probably damaging	Het
Mgat5	C	A	1: 127,469,237	H574N	probably damaging	Het
Moxd1	A	C	10: 24,284,760	D437A	probably damaging	Het
Ncs1	T	A	2: 31,287,360	L183Q	probably damaging	Het
Neto2	A	T	8: 85,663,215	D206E	probably damaging	Het
Omp	A	G	7: 98,145,339	L27P	probably damaging	Het
Oxsm	A	G	14: 16,242,287	S161P	probably benign	Het
Pde4b	A	G	4: 102,601,898	I381M	possibly damaging	Het
Pramel5	A	T	4: 144,273,105	N137K	probably benign	Het
Prss33	T	C	17: 23,833,960	S247G	probably damaging	Het
Rassf9	T	A	10: 102,546,038	L425Q	possibly damaging	Het
Setx	A	T	2: 29,158,114	D1909V	probably damaging	Het
Slc26a3	A	T	12: 31,457,346	K402*	probably null	Het
Slco1a6	G	A	6: 142,133,215	T118I	probably damaging	Het
Syne1	A	G	10: 5,128,416	L6769P	probably damaging	Het
Tas2r107	A	T	6: 131,659,489	V199D	possibly damaging	Het
Tchp	A	G	5: 114,720,015		probably null	Het
Trdn	A	T	10: 33,474,487	N684I	probably damaging	Het
Trio	G	T	15: 27,854,996	T700K	probably benign	Het
Ttn	C	T	2: 76,755,898	V20084I	probably benign	Het
Ubl3	A	T	5: 148,509,306	Y62*	probably null	Het
Uckl1	A	G	2: 181,573,260	Y267H	possibly damaging	Het
Zfp786	T	C	6: 47,826,986	N41D	probably damaging	Het
Zfp983	T	C	17: 21,662,085	S310P	probably damaging	Het

Other mutations in Mybpc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Mybpc2	APN	7	44505405	unclassified	probably benign
IGL00586:Mybpc2	APN	7	44505382	missense	probably damaging	0.96
IGL00976:Mybpc2	APN	7	44522317	splice site	probably null
IGL01099:Mybpc2	APN	7	44516167	missense	probably damaging	0.99
IGL01348:Mybpc2	APN	7	44515928	missense	probably benign
IGL01625:Mybpc2	APN	7	44516913	missense	possibly damaging	0.65
IGL01733:Mybpc2	APN	7	44506198	missense	probably benign	0.03
IGL01946:Mybpc2	APN	7	44509898	unclassified	probably benign
IGL02078:Mybpc2	APN	7	44503780	missense	probably damaging	1.00
IGL02314:Mybpc2	APN	7	44522388	missense	possibly damaging	0.82
IGL02341:Mybpc2	APN	7	44514930	missense	probably benign	0.00
IGL02904:Mybpc2	APN	7	44522341	missense	probably benign	0.05
IGL03034:Mybpc2	APN	7	44511897	missense	possibly damaging	0.87
IGL03296:Mybpc2	APN	7	44506884	missense	probably damaging	1.00
R0094:Mybpc2	UTSW	7	44516904	missense	probably damaging	1.00
R0329:Mybpc2	UTSW	7	44509029	missense	possibly damaging	0.94
R0330:Mybpc2	UTSW	7	44509029	missense	possibly damaging	0.94
R0336:Mybpc2	UTSW	7	44505616	missense	probably damaging	1.00
R0503:Mybpc2	UTSW	7	44512570	unclassified	probably benign
R0821:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0822:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0823:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0854:Mybpc2	UTSW	7	44517002	missense	probably benign	0.06
R0938:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0939:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0940:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0941:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R1166:Mybpc2	UTSW	7	44505025	missense	possibly damaging	0.84
R1219:Mybpc2	UTSW	7	44516034	splice site	probably null
R1559:Mybpc2	UTSW	7	44513687	missense	probably benign	0.01
R1732:Mybpc2	UTSW	7	44513675	missense	probably benign
R1802:Mybpc2	UTSW	7	44512470	missense	possibly damaging	0.81
R2157:Mybpc2	UTSW	7	44509845	missense	possibly damaging	0.93
R2216:Mybpc2	UTSW	7	44512500	splice site	probably null
R2406:Mybpc2	UTSW	7	44521725	missense	possibly damaging	0.62
R2411:Mybpc2	UTSW	7	44506238	missense	probably damaging	1.00
R3079:Mybpc2	UTSW	7	44506081	missense	probably damaging	1.00
R4663:Mybpc2	UTSW	7	44505642	missense	probably damaging	0.99
R4736:Mybpc2	UTSW	7	44512547	missense	probably damaging	1.00
R5316:Mybpc2	UTSW	7	44520382	nonsense	probably null
R5426:Mybpc2	UTSW	7	44509829	missense	probably benign	0.01
R5498:Mybpc2	UTSW	7	44516265	missense	probably damaging	1.00
R5539:Mybpc2	UTSW	7	44514893	missense	probably benign	0.17
R5644:Mybpc2	UTSW	7	44507053	missense	probably benign	0.13
R5909:Mybpc2	UTSW	7	44507091	missense	probably damaging	1.00
R6435:Mybpc2	UTSW	7	44506057	missense	possibly damaging	0.73
R6901:Mybpc2	UTSW	7	44505355	missense	probably damaging	0.99
R7188:Mybpc2	UTSW	7	44506193	missense	probably benign	0.06
R7389:Mybpc2	UTSW	7	44505604	missense	probably benign	0.11
R7405:Mybpc2	UTSW	7	44507194	missense	probably damaging	1.00
R7553:Mybpc2	UTSW	7	44506147	missense	possibly damaging	0.51
R7597:Mybpc2	UTSW	7	44509799	missense	probably damaging	1.00
R7772:Mybpc2	UTSW	7	44515924	critical splice donor site	probably null
R7824:Mybpc2	UTSW	7	44504860	splice site	probably null
R8003:Mybpc2	UTSW	7	44509064	missense	probably damaging	0.99
R8179:Mybpc2	UTSW	7	44509830	missense	probably benign	0.01
R8187:Mybpc2	UTSW	7	44512470	missense	possibly damaging	0.81
R8413:Mybpc2	UTSW	7	44508305	missense	probably damaging	1.00
R8729:Mybpc2	UTSW	7	44506187	missense	probably damaging	1.00
R8830:Mybpc2	UTSW	7	44512541	missense	probably damaging	1.00
R9377:Mybpc2	UTSW	7	44509575	missense	probably benign	0.22
R9441:Mybpc2	UTSW	7	44516906	missense	probably null	0.96
X0052:Mybpc2	UTSW	7	44507142	missense	probably benign	0.23
X0065:Mybpc2	UTSW	7	44505385	missense	probably benign	0.01
Z1088:Mybpc2	UTSW	7	44516503	missense	possibly damaging	0.47
Z1176:Mybpc2	UTSW	7	44521696	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCTGAGAGTCCCTAAAGCCTGG -3'
(R):5'- CAGGAAGTTGTCAGGCCTTG -3'

Sequencing Primer
(F):5'- TTTTGACAGTAGCCCAGGC -3'
(R):5'- CCTTGGGCCAGTGATGTAG -3'

Posted On

2018-07-24