Incidental Mutation 'R6662:Omp'
ID528021
Institutional Source Beutler Lab
Gene Symbol Omp
Ensembl Gene ENSMUSG00000074006
Gene Nameolfactory marker protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6662 (G1)
Quality Score201.009
Status Validated
Chromosome7
Chromosomal Location98143359-98145502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98145339 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 27 (L27P)
Ref Sequence ENSEMBL: ENSMUSP00000095882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000098281] [ENSMUST00000107112]
PDB Structure
CRYSTAL STRUCTURE OF MURINE OLFACTORY MARKER PROTEIN [X-RAY DIFFRACTION]
Crystal Structure of Murine Olfactory Marker Protein in Spacegroup P3121 [X-RAY DIFFRACTION]
Crystal Structure of Murine Olfactory Marker Protein in Spacegroup P43212 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000040971
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098281
AA Change: L27P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095882
Gene: ENSMUSG00000074006
AA Change: L27P

DomainStartEndE-ValueType
Pfam:Olfactory_mark 11 161 7.6e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107112
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134638
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Olfactory marker protein is uniquely associated with the mature olfactory receptor neurons in many vertebrate species from fish to man. The OMP gene structure and protein sequence are highly conserved between mouse, rat and human. Results of the mouse knockout studies show that OMP-null mice are compromised in their ability to respond to odor stimuli, and that OMP represents a novel modulatory component of the odor detection/signal transduction cascade. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking both copies of the coding sequence for this gene exhibit no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Omp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Omp APN 7 98145150 missense probably damaging 1.00
IGL01361:Omp APN 7 98145282 missense probably benign 0.04
R1589:Omp UTSW 7 98145359 missense probably benign 0.00
R2510:Omp UTSW 7 98145345 missense possibly damaging 0.64
R3722:Omp UTSW 7 98145213 missense probably benign 0.01
R4612:Omp UTSW 7 98145141 missense probably damaging 0.99
R4876:Omp UTSW 7 98145026 missense probably benign
R6844:Omp UTSW 7 98145076 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCCTTGCGCCAGAAGATG -3'
(R):5'- TCTTCTCTTGGCATCGGAGG -3'

Sequencing Primer
(F):5'- TCCAGTTCTGCGAGGTGC -3'
(R):5'- GAGGATCCAGCCCACTTGATTC -3'
Posted On2018-07-24