Incidental Mutation 'R6662:Omp'
ID 528021
Institutional Source Beutler Lab
Gene Symbol Omp
Ensembl Gene ENSMUSG00000074006
Gene Name olfactory marker protein
Synonyms
MMRRC Submission 044782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R6662 (G1)
Quality Score 201.009
Status Validated
Chromosome 7
Chromosomal Location 97792566-97794654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97794546 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 27 (L27P)
Ref Sequence ENSEMBL: ENSMUSP00000095882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000098281] [ENSMUST00000107112]
AlphaFold Q64288
PDB Structure CRYSTAL STRUCTURE OF MURINE OLFACTORY MARKER PROTEIN [X-RAY DIFFRACTION]
Crystal Structure of Murine Olfactory Marker Protein in Spacegroup P3121 [X-RAY DIFFRACTION]
Crystal Structure of Murine Olfactory Marker Protein in Spacegroup P43212 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000040971
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098281
AA Change: L27P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095882
Gene: ENSMUSG00000074006
AA Change: L27P

DomainStartEndE-ValueType
Pfam:Olfactory_mark 11 161 7.6e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107112
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134638
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Olfactory marker protein is uniquely associated with the mature olfactory receptor neurons in many vertebrate species from fish to man. The OMP gene structure and protein sequence are highly conserved between mouse, rat and human. Results of the mouse knockout studies show that OMP-null mice are compromised in their ability to respond to odor stimuli, and that OMP represents a novel modulatory component of the odor detection/signal transduction cascade. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking both copies of the coding sequence for this gene exhibit no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,062,285 (GRCm39) probably null Het
Acox1 A G 11: 116,066,149 (GRCm39) Y418H probably damaging Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Aldh3a1 G A 11: 61,105,481 (GRCm39) V196I probably benign Het
Aox3 A G 1: 58,157,774 (GRCm39) K44E probably damaging Het
Bad T A 19: 6,928,438 (GRCm39) probably benign Het
BC034090 G T 1: 155,102,085 (GRCm39) Q60K possibly damaging Het
Casp6 A G 3: 129,705,875 (GRCm39) T181A probably benign Het
Catsperg2 G A 7: 29,418,938 (GRCm39) probably benign Het
Ccdc14 T C 16: 34,511,164 (GRCm39) L46P probably damaging Het
Ces1b A G 8: 93,790,697 (GRCm39) L364S probably benign Het
Cfap45 T C 1: 172,357,417 (GRCm39) I15T probably benign Het
Dph5 G A 3: 115,722,205 (GRCm39) E228K probably benign Het
Fat4 G T 3: 39,010,970 (GRCm39) L2023F possibly damaging Het
Garem1 T C 18: 21,281,304 (GRCm39) N351D probably benign Het
Grm2 C T 9: 106,525,252 (GRCm39) A488T probably benign Het
Ifit3b A G 19: 34,589,337 (GRCm39) E171G probably damaging Het
Il1rn A T 2: 24,226,887 (GRCm39) probably null Het
Itih5 A T 2: 10,253,992 (GRCm39) I748F probably benign Het
Kcnh5 C A 12: 75,054,385 (GRCm39) D520Y probably damaging Het
Mgat5 C A 1: 127,396,974 (GRCm39) H574N probably damaging Het
Moxd1 A C 10: 24,160,658 (GRCm39) D437A probably damaging Het
Mybpc2 A G 7: 44,155,590 (GRCm39) F888L probably benign Het
Ncs1 T A 2: 31,177,372 (GRCm39) L183Q probably damaging Het
Neto2 A T 8: 86,389,844 (GRCm39) D206E probably damaging Het
Oxsm A G 14: 16,242,287 (GRCm38) S161P probably benign Het
Pate6 C A 9: 35,701,296 (GRCm39) R6M possibly damaging Het
Pde4b A G 4: 102,459,095 (GRCm39) I381M possibly damaging Het
Pramel5 A T 4: 143,999,675 (GRCm39) N137K probably benign Het
Prss33 T C 17: 24,052,934 (GRCm39) S247G probably damaging Het
Rassf9 T A 10: 102,381,899 (GRCm39) L425Q possibly damaging Het
Setx A T 2: 29,048,126 (GRCm39) D1909V probably damaging Het
Slc26a3 A T 12: 31,507,345 (GRCm39) K402* probably null Het
Slco1a6 G A 6: 142,078,941 (GRCm39) T118I probably damaging Het
Syne1 A G 10: 5,078,416 (GRCm39) L6769P probably damaging Het
Tas2r107 A T 6: 131,636,452 (GRCm39) V199D possibly damaging Het
Tchp A G 5: 114,858,076 (GRCm39) probably null Het
Trdn A T 10: 33,350,483 (GRCm39) N684I probably damaging Het
Trio G T 15: 27,855,082 (GRCm39) T700K probably benign Het
Ttn C T 2: 76,586,242 (GRCm39) V20084I probably benign Het
Ubl3 A T 5: 148,446,116 (GRCm39) Y62* probably null Het
Uckl1 A G 2: 181,215,053 (GRCm39) Y267H possibly damaging Het
Zfp1005 G A 2: 150,108,172 (GRCm39) probably null Het
Zfp786 T C 6: 47,803,920 (GRCm39) N41D probably damaging Het
Zfp983 T C 17: 21,881,001 (GRCm39) S310P probably damaging Het
Other mutations in Omp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Omp APN 7 97,794,357 (GRCm39) missense probably damaging 1.00
IGL01361:Omp APN 7 97,794,489 (GRCm39) missense probably benign 0.04
R1589:Omp UTSW 7 97,794,566 (GRCm39) missense probably benign 0.00
R2510:Omp UTSW 7 97,794,552 (GRCm39) missense possibly damaging 0.64
R3722:Omp UTSW 7 97,794,420 (GRCm39) missense probably benign 0.01
R4612:Omp UTSW 7 97,794,348 (GRCm39) missense probably damaging 0.99
R4876:Omp UTSW 7 97,794,233 (GRCm39) missense probably benign
R6844:Omp UTSW 7 97,794,283 (GRCm39) missense probably benign 0.00
R8440:Omp UTSW 7 97,794,253 (GRCm39) missense probably damaging 1.00
R9013:Omp UTSW 7 97,794,552 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCCTTGCGCCAGAAGATG -3'
(R):5'- TCTTCTCTTGGCATCGGAGG -3'

Sequencing Primer
(F):5'- TCCAGTTCTGCGAGGTGC -3'
(R):5'- GAGGATCCAGCCCACTTGATTC -3'
Posted On 2018-07-24