Mutagenetix > Incidental Mutation

Incidental Mutation 'R6662:Neto2'

528022

Institutional Source

Beutler Lab

Gene Symbol

Neto2

Ensembl Gene

ENSMUSG00000036902

Gene Name

neuropilin (NRP) and tolloid (TLL)-like 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.140) question?

Stock #

R6662 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85636588-85700924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85663215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 206 (D206E)

Ref Sequence

ENSEMBL: ENSMUSP00000150062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]

AlphaFold

Q8BNJ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000109686
AA Change: D234E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: D234E

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
CUB	80	194	2.56e-40	SMART
CUB	205	320	9.11e-5	SMART
LDLa	324	361	5.73e-5	SMART
transmembrane domain	374	396	N/A	INTRINSIC
coiled coil region	432	460	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209259

Predicted Effect

probably damaging
Transcript: ENSMUST00000209479
AA Change: D199E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215046

Predicted Effect

probably damaging
Transcript: ENSMUST00000216286
AA Change: D206E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox1	A	G	11: 116,175,323	Y418H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Aldh3a1	G	A	11: 61,214,655	V196I	probably benign	Het
Aox3	A	G	1: 58,118,615	K44E	probably damaging	Het
Bad	T	A	19: 6,951,070		probably benign	Het
BC034090	G	T	1: 155,226,339	Q60K	possibly damaging	Het
Casp6	A	G	3: 129,912,226	T181A	probably benign	Het
Catsperg2	G	A	7: 29,719,513		probably benign	Het
Ccdc14	T	C	16: 34,690,794	L46P	probably damaging	Het
Ces1b	A	G	8: 93,064,069	L364S	probably benign	Het
Cfap45	T	C	1: 172,529,850	I15T	probably benign	Het
D730048I06Rik	C	A	9: 35,790,000	R6M	possibly damaging	Het
Dph5	G	A	3: 115,928,556	E228K	probably benign	Het
Fat4	G	T	3: 38,956,821	L2023F	possibly damaging	Het
Garem1	T	C	18: 21,148,247	N351D	probably benign	Het
Gm14124	G	A	2: 150,266,252		probably null	Het
Grm2	C	T	9: 106,648,053	A488T	probably benign	Het
Ifit3b	A	G	19: 34,611,937	E171G	probably damaging	Het
Il1rn	A	T	2: 24,336,875		probably null	Het
Itih5	A	T	2: 10,249,181	I748F	probably benign	Het
Kcnh5	C	A	12: 75,007,611	D520Y	probably damaging	Het
Mgat5	C	A	1: 127,469,237	H574N	probably damaging	Het
Moxd1	A	C	10: 24,284,760	D437A	probably damaging	Het
Mybpc2	A	G	7: 44,506,166	F888L	probably benign	Het
Ncs1	T	A	2: 31,287,360	L183Q	probably damaging	Het
Omp	A	G	7: 98,145,339	L27P	probably damaging	Het
Oxsm	A	G	14: 16,242,287	S161P	probably benign	Het
Pde4b	A	G	4: 102,601,898	I381M	possibly damaging	Het
Pramel5	A	T	4: 144,273,105	N137K	probably benign	Het
Prss33	T	C	17: 23,833,960	S247G	probably damaging	Het
Rassf9	T	A	10: 102,546,038	L425Q	possibly damaging	Het
Setx	A	T	2: 29,158,114	D1909V	probably damaging	Het
Slc26a3	A	T	12: 31,457,346	K402*	probably null	Het
Slco1a6	G	A	6: 142,133,215	T118I	probably damaging	Het
Syne1	A	G	10: 5,128,416	L6769P	probably damaging	Het
Tas2r107	A	T	6: 131,659,489	V199D	possibly damaging	Het
Tchp	A	G	5: 114,720,015		probably null	Het
Trdn	A	T	10: 33,474,487	N684I	probably damaging	Het
Trio	G	T	15: 27,854,996	T700K	probably benign	Het
Ttn	C	T	2: 76,755,898	V20084I	probably benign	Het
Ubl3	A	T	5: 148,509,306	Y62*	probably null	Het
Uckl1	A	G	2: 181,573,260	Y267H	possibly damaging	Het
Zfp786	T	C	6: 47,826,986	N41D	probably damaging	Het
Zfp983	T	C	17: 21,662,085	S310P	probably damaging	Het

Other mutations in Neto2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01705:Neto2	APN	8	85641003	missense	probably damaging	1.00
IGL01938:Neto2	APN	8	85690855	missense	probably benign	0.00
IGL02238:Neto2	APN	8	85669663	missense	probably damaging	0.99
IGL02605:Neto2	APN	8	85663435	splice site	probably benign
IGL02813:Neto2	APN	8	85690886	missense	probably benign
R0138:Neto2	UTSW	8	85641044	missense	possibly damaging	0.72
R1934:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R2402:Neto2	UTSW	8	85690912	missense	probably benign	0.00
R2423:Neto2	UTSW	8	85669767	missense	probably damaging	1.00
R3821:Neto2	UTSW	8	85663295	nonsense	probably null
R3822:Neto2	UTSW	8	85663295	nonsense	probably null
R3883:Neto2	UTSW	8	85663265	missense	probably damaging	1.00
R3939:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3940:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3941:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R4433:Neto2	UTSW	8	85641083	missense	probably damaging	1.00
R4668:Neto2	UTSW	8	85641062	missense	probably damaging	1.00
R4675:Neto2	UTSW	8	85669704	missense	probably damaging	1.00
R4908:Neto2	UTSW	8	85669764	missense	probably damaging	0.99
R5459:Neto2	UTSW	8	85670483	missense	probably benign	0.35
R5471:Neto2	UTSW	8	85640760	missense	probably benign	0.41
R5544:Neto2	UTSW	8	85647877	missense	possibly damaging	0.94
R5571:Neto2	UTSW	8	85640544	missense	probably damaging	1.00
R6083:Neto2	UTSW	8	85640585	missense	probably benign	0.00
R6339:Neto2	UTSW	8	85640558	missense	probably benign	0.33
R6381:Neto2	UTSW	8	85642509	missense	probably damaging	0.99
R6572:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R6593:Neto2	UTSW	8	85669546	missense	probably damaging	1.00
R6881:Neto2	UTSW	8	85640556	missense	probably damaging	1.00
R6950:Neto2	UTSW	8	85670443	missense	probably damaging	1.00
R7121:Neto2	UTSW	8	85670391	splice site	probably null
R7754:Neto2	UTSW	8	85669700	missense	probably damaging	0.98
R7755:Neto2	UTSW	8	85669656	missense	probably damaging	1.00
R8682:Neto2	UTSW	8	85640666	missense	probably benign	0.01
R9326:Neto2	UTSW	8	85642434	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACTATAATCTTCATAGGTGCCC -3'
(R):5'- CAGATCCAGACTTTACTTACCTTGG -3'

Sequencing Primer
(F):5'- TCTTCATAGGTGCCCAATACAG -3'
(R):5'- GGAGGTATTTTAAATCCCATTCCAGG -3'

Posted On

2018-07-24