Incidental Mutation 'R6662:Neto2'
ID 528022
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Name neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms 5530601C23Rik
MMRRC Submission 044782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 86363217-86427553 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86389844 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 206 (D206E)
Ref Sequence ENSEMBL: ENSMUSP00000150062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
AlphaFold Q8BNJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000109686
AA Change: D234E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: D234E

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably damaging
Transcript: ENSMUST00000209479
AA Change: D199E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably damaging
Transcript: ENSMUST00000216286
AA Change: D206E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,062,285 (GRCm39) probably null Het
Acox1 A G 11: 116,066,149 (GRCm39) Y418H probably damaging Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Aldh3a1 G A 11: 61,105,481 (GRCm39) V196I probably benign Het
Aox3 A G 1: 58,157,774 (GRCm39) K44E probably damaging Het
Bad T A 19: 6,928,438 (GRCm39) probably benign Het
BC034090 G T 1: 155,102,085 (GRCm39) Q60K possibly damaging Het
Casp6 A G 3: 129,705,875 (GRCm39) T181A probably benign Het
Catsperg2 G A 7: 29,418,938 (GRCm39) probably benign Het
Ccdc14 T C 16: 34,511,164 (GRCm39) L46P probably damaging Het
Ces1b A G 8: 93,790,697 (GRCm39) L364S probably benign Het
Cfap45 T C 1: 172,357,417 (GRCm39) I15T probably benign Het
Dph5 G A 3: 115,722,205 (GRCm39) E228K probably benign Het
Fat4 G T 3: 39,010,970 (GRCm39) L2023F possibly damaging Het
Garem1 T C 18: 21,281,304 (GRCm39) N351D probably benign Het
Grm2 C T 9: 106,525,252 (GRCm39) A488T probably benign Het
Ifit3b A G 19: 34,589,337 (GRCm39) E171G probably damaging Het
Il1rn A T 2: 24,226,887 (GRCm39) probably null Het
Itih5 A T 2: 10,253,992 (GRCm39) I748F probably benign Het
Kcnh5 C A 12: 75,054,385 (GRCm39) D520Y probably damaging Het
Mgat5 C A 1: 127,396,974 (GRCm39) H574N probably damaging Het
Moxd1 A C 10: 24,160,658 (GRCm39) D437A probably damaging Het
Mybpc2 A G 7: 44,155,590 (GRCm39) F888L probably benign Het
Ncs1 T A 2: 31,177,372 (GRCm39) L183Q probably damaging Het
Omp A G 7: 97,794,546 (GRCm39) L27P probably damaging Het
Oxsm A G 14: 16,242,287 (GRCm38) S161P probably benign Het
Pate6 C A 9: 35,701,296 (GRCm39) R6M possibly damaging Het
Pde4b A G 4: 102,459,095 (GRCm39) I381M possibly damaging Het
Pramel5 A T 4: 143,999,675 (GRCm39) N137K probably benign Het
Prss33 T C 17: 24,052,934 (GRCm39) S247G probably damaging Het
Rassf9 T A 10: 102,381,899 (GRCm39) L425Q possibly damaging Het
Setx A T 2: 29,048,126 (GRCm39) D1909V probably damaging Het
Slc26a3 A T 12: 31,507,345 (GRCm39) K402* probably null Het
Slco1a6 G A 6: 142,078,941 (GRCm39) T118I probably damaging Het
Syne1 A G 10: 5,078,416 (GRCm39) L6769P probably damaging Het
Tas2r107 A T 6: 131,636,452 (GRCm39) V199D possibly damaging Het
Tchp A G 5: 114,858,076 (GRCm39) probably null Het
Trdn A T 10: 33,350,483 (GRCm39) N684I probably damaging Het
Trio G T 15: 27,855,082 (GRCm39) T700K probably benign Het
Ttn C T 2: 76,586,242 (GRCm39) V20084I probably benign Het
Ubl3 A T 5: 148,446,116 (GRCm39) Y62* probably null Het
Uckl1 A G 2: 181,215,053 (GRCm39) Y267H possibly damaging Het
Zfp1005 G A 2: 150,108,172 (GRCm39) probably null Het
Zfp786 T C 6: 47,803,920 (GRCm39) N41D probably damaging Het
Zfp983 T C 17: 21,881,001 (GRCm39) S310P probably damaging Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 86,367,632 (GRCm39) missense probably damaging 1.00
IGL01938:Neto2 APN 8 86,417,484 (GRCm39) missense probably benign 0.00
IGL02238:Neto2 APN 8 86,396,292 (GRCm39) missense probably damaging 0.99
IGL02605:Neto2 APN 8 86,390,064 (GRCm39) splice site probably benign
IGL02813:Neto2 APN 8 86,417,515 (GRCm39) missense probably benign
R0138:Neto2 UTSW 8 86,367,673 (GRCm39) missense possibly damaging 0.72
R1934:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R2402:Neto2 UTSW 8 86,417,541 (GRCm39) missense probably benign 0.00
R2423:Neto2 UTSW 8 86,396,396 (GRCm39) missense probably damaging 1.00
R3821:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3822:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3883:Neto2 UTSW 8 86,389,894 (GRCm39) missense probably damaging 1.00
R3939:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3940:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3941:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R4433:Neto2 UTSW 8 86,367,712 (GRCm39) missense probably damaging 1.00
R4668:Neto2 UTSW 8 86,367,691 (GRCm39) missense probably damaging 1.00
R4675:Neto2 UTSW 8 86,396,333 (GRCm39) missense probably damaging 1.00
R4908:Neto2 UTSW 8 86,396,393 (GRCm39) missense probably damaging 0.99
R5459:Neto2 UTSW 8 86,397,112 (GRCm39) missense probably benign 0.35
R5471:Neto2 UTSW 8 86,367,389 (GRCm39) missense probably benign 0.41
R5544:Neto2 UTSW 8 86,374,506 (GRCm39) missense possibly damaging 0.94
R5571:Neto2 UTSW 8 86,367,173 (GRCm39) missense probably damaging 1.00
R6083:Neto2 UTSW 8 86,367,214 (GRCm39) missense probably benign 0.00
R6339:Neto2 UTSW 8 86,367,187 (GRCm39) missense probably benign 0.33
R6381:Neto2 UTSW 8 86,369,138 (GRCm39) missense probably damaging 0.99
R6572:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R6593:Neto2 UTSW 8 86,396,175 (GRCm39) missense probably damaging 1.00
R6881:Neto2 UTSW 8 86,367,185 (GRCm39) missense probably damaging 1.00
R6950:Neto2 UTSW 8 86,397,072 (GRCm39) missense probably damaging 1.00
R7121:Neto2 UTSW 8 86,397,020 (GRCm39) splice site probably null
R7754:Neto2 UTSW 8 86,396,329 (GRCm39) missense probably damaging 0.98
R7755:Neto2 UTSW 8 86,396,285 (GRCm39) missense probably damaging 1.00
R8682:Neto2 UTSW 8 86,367,295 (GRCm39) missense probably benign 0.01
R9326:Neto2 UTSW 8 86,369,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTATAATCTTCATAGGTGCCC -3'
(R):5'- CAGATCCAGACTTTACTTACCTTGG -3'

Sequencing Primer
(F):5'- TCTTCATAGGTGCCCAATACAG -3'
(R):5'- GGAGGTATTTTAAATCCCATTCCAGG -3'
Posted On 2018-07-24