Incidental Mutation 'R6662:D730048I06Rik'
ID 528024
Institutional Source Beutler Lab
Gene Symbol D730048I06Rik
Ensembl Gene ENSMUSG00000032108
Gene Name RIKEN cDNA D730048I06 gene
Synonyms Pate-C, mANLP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 35788050-35790112 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 35790000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Methionine at position 6 (R6M)
Ref Sequence ENSEMBL: ENSMUSP00000139380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034619] [ENSMUST00000184431]
AlphaFold Q9CQB8
Predicted Effect possibly damaging
Transcript: ENSMUST00000034619
AA Change: R6M

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034619
Gene: ENSMUSG00000032108
AA Change: R6M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000184431
AA Change: R6M

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139380
Gene: ENSMUSG00000098847
AA Change: R6M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in D730048I06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1113:D730048I06Rik UTSW 9 35789089 missense probably benign 0.03
R1308:D730048I06Rik UTSW 9 35789089 missense probably benign 0.03
R1971:D730048I06Rik UTSW 9 35789013 missense probably benign 0.00
R2132:D730048I06Rik UTSW 9 35789743 splice site probably benign
R4700:D730048I06Rik UTSW 9 35789725 missense probably damaging 0.98
R5809:D730048I06Rik UTSW 9 35789001 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCTGGATAGCTTAGCTGTACC -3'
(R):5'- TAGTGCCACCTGAAACAAGG -3'

Sequencing Primer
(F):5'- CCAATGTTTTGGCTTACAGACATGC -3'
(R):5'- CCAGTGTGGGAGGAGCTTAC -3'
Posted On 2018-07-24