Incidental Mutation 'R6662:Grm2'
ID528025
Institutional Source Beutler Lab
Gene Symbol Grm2
Ensembl Gene ENSMUSG00000023192
Gene Nameglutamate receptor, metabotropic 2
Synonyms4930441L02Rik, mGluR2, Gprc1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R6662 (G1)
Quality Score209.009
Status Validated
Chromosome9
Chromosomal Location106643095-106656082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106648053 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 488 (A488T)
Ref Sequence ENSEMBL: ENSMUSP00000023959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023959] [ENSMUST00000201681]
Predicted Effect probably benign
Transcript: ENSMUST00000023959
AA Change: A488T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023959
Gene: ENSMUSG00000023192
AA Change: A488T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 60 460 1.3e-96 PFAM
Pfam:NCD3G 496 546 3.7e-13 PFAM
Pfam:7tm_3 579 816 4.3e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187786
Predicted Effect unknown
Transcript: ENSMUST00000200826
AA Change: A17T
Predicted Effect probably benign
Transcript: ENSMUST00000201681
SMART Domains Protein: ENSMUSP00000144631
Gene: ENSMUSG00000023192

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 60 460 4.1e-95 PFAM
Pfam:7tm_3 458 538 4.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201955
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile behavioral modifications and moderate abnormalities in long term depression and EPSP in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Grm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1053:Grm2 UTSW 9 106648157 missense probably damaging 0.98
R1116:Grm2 UTSW 9 106647927 missense probably damaging 0.97
R1593:Grm2 UTSW 9 106650914 missense probably damaging 1.00
R1619:Grm2 UTSW 9 106647471 missense probably damaging 1.00
R2174:Grm2 UTSW 9 106647795 missense probably benign 0.05
R2357:Grm2 UTSW 9 106647581 missense probably damaging 0.99
R3115:Grm2 UTSW 9 106647623 missense probably damaging 0.97
R4453:Grm2 UTSW 9 106653879 missense probably damaging 0.97
R4700:Grm2 UTSW 9 106653931 missense probably benign 0.18
R4854:Grm2 UTSW 9 106654132 missense possibly damaging 0.80
R4871:Grm2 UTSW 9 106647645 missense probably benign 0.00
R4888:Grm2 UTSW 9 106650666 missense probably damaging 0.98
R4999:Grm2 UTSW 9 106653990 missense probably damaging 1.00
R5617:Grm2 UTSW 9 106651076 unclassified probably null
R5620:Grm2 UTSW 9 106650446 missense probably damaging 0.96
R6021:Grm2 UTSW 9 106650800 missense probably damaging 1.00
R6089:Grm2 UTSW 9 106653891 missense probably damaging 1.00
R7061:Grm2 UTSW 9 106651225 missense probably damaging 0.98
R7266:Grm2 UTSW 9 106647171 missense
R7270:Grm2 UTSW 9 106651058 missense probably damaging 0.98
R7479:Grm2 UTSW 9 106653851 missense possibly damaging 0.84
R7542:Grm2 UTSW 9 106651169 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTCAGACTGGCATTAGGC -3'
(R):5'- AGGTCACATCAGAGGACCTC -3'

Sequencing Primer
(F):5'- CCAGTAGCCCAGGCCACAG -3'
(R):5'- ATCAGAGGACCTCACCGG -3'
Posted On2018-07-24