Incidental Mutation 'R6662:Moxd1'
ID 528027
Institutional Source Beutler Lab
Gene Symbol Moxd1
Ensembl Gene ENSMUSG00000020000
Gene Name monooxygenase, DBH-like 1
Synonyms 3230402N08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 24223517-24302790 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 24284760 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 437 (D437A)
Ref Sequence ENSEMBL: ENSMUSP00000093460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095784]
AlphaFold Q9CXI3
Predicted Effect probably damaging
Transcript: ENSMUST00000095784
AA Change: D437A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093460
Gene: ENSMUSG00000020000
AA Change: D437A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DoH 59 148 7.89e-15 SMART
Pfam:Cu2_monooxygen 186 315 2.7e-50 PFAM
Pfam:Cu2_monoox_C 334 491 2.1e-48 PFAM
low complexity region 602 613 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Moxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Moxd1 APN 10 24279864 missense probably damaging 1.00
IGL00227:Moxd1 APN 10 24282593 missense probably damaging 1.00
IGL00331:Moxd1 APN 10 24282555 splice site probably benign
IGL01074:Moxd1 APN 10 24279384 missense probably benign 0.45
IGL01462:Moxd1 APN 10 24244388 critical splice donor site probably null
IGL01777:Moxd1 APN 10 24252596 missense probably benign 0.00
IGL02051:Moxd1 APN 10 24253018 splice site probably null
IGL02272:Moxd1 APN 10 24282700 nonsense probably null
IGL02343:Moxd1 APN 10 24279864 missense probably damaging 1.00
IGL02425:Moxd1 APN 10 24279436 missense probably benign 0.01
IGL02448:Moxd1 APN 10 24282719 missense probably damaging 0.99
IGL02452:Moxd1 APN 10 24282752 missense probably damaging 1.00
IGL03301:Moxd1 APN 10 24279484 missense probably damaging 0.99
R0631:Moxd1 UTSW 10 24252954 missense probably damaging 1.00
R1436:Moxd1 UTSW 10 24244358 missense probably damaging 1.00
R1484:Moxd1 UTSW 10 24223860 missense probably damaging 1.00
R1574:Moxd1 UTSW 10 24300319 missense probably damaging 1.00
R1574:Moxd1 UTSW 10 24300319 missense probably damaging 1.00
R1713:Moxd1 UTSW 10 24281496 missense probably damaging 1.00
R1954:Moxd1 UTSW 10 24279883 missense probably benign 0.17
R3115:Moxd1 UTSW 10 24301531 nonsense probably null
R3116:Moxd1 UTSW 10 24301531 nonsense probably null
R5183:Moxd1 UTSW 10 24279547 critical splice donor site probably null
R5183:Moxd1 UTSW 10 24287136 missense probably damaging 1.00
R5322:Moxd1 UTSW 10 24244253 missense possibly damaging 0.88
R5728:Moxd1 UTSW 10 24223683 missense possibly damaging 0.92
R5824:Moxd1 UTSW 10 24287097 missense probably damaging 1.00
R6158:Moxd1 UTSW 10 24284777 missense probably damaging 1.00
R6322:Moxd1 UTSW 10 24284811 missense probably damaging 1.00
R6827:Moxd1 UTSW 10 24279850 missense probably benign 0.29
R6928:Moxd1 UTSW 10 24300288 missense probably damaging 1.00
R7048:Moxd1 UTSW 10 24281476 missense probably damaging 1.00
R7320:Moxd1 UTSW 10 24301465 missense probably benign 0.05
R7736:Moxd1 UTSW 10 24282710 missense probably damaging 1.00
R8060:Moxd1 UTSW 10 24301612 missense unknown
R8073:Moxd1 UTSW 10 24252950 missense probably damaging 1.00
R8089:Moxd1 UTSW 10 24281519 missense probably benign 0.43
R8255:Moxd1 UTSW 10 24223802 missense probably benign 0.02
R8314:Moxd1 UTSW 10 24252540 missense possibly damaging 0.81
R9099:Moxd1 UTSW 10 24279864 missense probably damaging 1.00
X0063:Moxd1 UTSW 10 24252500 missense probably benign 0.18
Z1177:Moxd1 UTSW 10 24284804 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGAGTCTGGTCTGAACTTGG -3'
(R):5'- TCACCTAATGATGCTTCAAGCTG -3'

Sequencing Primer
(F):5'- TCTGAACTTGGAGGGTCCTC -3'
(R):5'- GAAGTAGTTCAGGGTTTTGTCTCAAG -3'
Posted On 2018-07-24