Mutagenetix > Incidental Mutations

Incidental Mutation 'R6662:Trdn'

528028

Institutional Source

Beutler Lab

Gene Symbol

Trdn

Ensembl Gene

ENSMUSG00000019787

Gene Name

triadin

Synonyms

triadin-2, triadin 2, triadin 1, triadin 3, EG432451, 2310045H21Rik, triadin-1, triadin-3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R6662 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33080554-33476709 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 33474487 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 684 (N684I)

Ref Sequence

ENSEMBL: ENSMUSP00000093436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095762]

AlphaFold

E9Q9K5

Predicted Effect

probably damaging
Transcript: ENSMUST00000095762
AA Change: N684I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000093436
Gene: ENSMUSG00000019787
AA Change: N684I

Domain	Start	End	E-Value	Type
SCOP:d1lnqa2	49	116	1e-4	SMART
low complexity region	147	158	N/A	INTRINSIC
low complexity region	166	182	N/A	INTRINSIC
low complexity region	198	223	N/A	INTRINSIC
low complexity region	229	250	N/A	INTRINSIC
coiled coil region	306	333	N/A	INTRINSIC
low complexity region	342	352	N/A	INTRINSIC
low complexity region	380	396	N/A	INTRINSIC
coiled coil region	417	437	N/A	INTRINSIC
low complexity region	448	484	N/A	INTRINSIC
low complexity region	539	551	N/A	INTRINSIC
low complexity region	559	572	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220089

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a loss of transverse orientation of triads within skeletal muscle cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox1	A	G	11: 116,175,323	Y418H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Aldh3a1	G	A	11: 61,214,655	V196I	probably benign	Het
Aox3	A	G	1: 58,118,615	K44E	probably damaging	Het
Bad	T	A	19: 6,951,070		probably benign	Het
BC034090	G	T	1: 155,226,339	Q60K	possibly damaging	Het
Casp6	A	G	3: 129,912,226	T181A	probably benign	Het
Catsperg2	G	A	7: 29,719,513		probably benign	Het
Ccdc14	T	C	16: 34,690,794	L46P	probably damaging	Het
Ces1b	A	G	8: 93,064,069	L364S	probably benign	Het
Cfap45	T	C	1: 172,529,850	I15T	probably benign	Het
D730048I06Rik	C	A	9: 35,790,000	R6M	possibly damaging	Het
Dph5	G	A	3: 115,928,556	E228K	probably benign	Het
Fat4	G	T	3: 38,956,821	L2023F	possibly damaging	Het
Garem1	T	C	18: 21,148,247	N351D	probably benign	Het
Gm14124	G	A	2: 150,266,252		probably null	Het
Grm2	C	T	9: 106,648,053	A488T	probably benign	Het
Ifit3b	A	G	19: 34,611,937	E171G	probably damaging	Het
Il1rn	A	T	2: 24,336,875		probably null	Het
Itih5	A	T	2: 10,249,181	I748F	probably benign	Het
Kcnh5	C	A	12: 75,007,611	D520Y	probably damaging	Het
Mgat5	C	A	1: 127,469,237	H574N	probably damaging	Het
Moxd1	A	C	10: 24,284,760	D437A	probably damaging	Het
Mybpc2	A	G	7: 44,506,166	F888L	probably benign	Het
Ncs1	T	A	2: 31,287,360	L183Q	probably damaging	Het
Neto2	A	T	8: 85,663,215	D206E	probably damaging	Het
Omp	A	G	7: 98,145,339	L27P	probably damaging	Het
Oxsm	A	G	14: 16,242,287	S161P	probably benign	Het
Pde4b	A	G	4: 102,601,898	I381M	possibly damaging	Het
Pramel5	A	T	4: 144,273,105	N137K	probably benign	Het
Prss33	T	C	17: 23,833,960	S247G	probably damaging	Het
Rassf9	T	A	10: 102,546,038	L425Q	possibly damaging	Het
Setx	A	T	2: 29,158,114	D1909V	probably damaging	Het
Slc26a3	A	T	12: 31,457,346	K402*	probably null	Het
Slco1a6	G	A	6: 142,133,215	T118I	probably damaging	Het
Syne1	A	G	10: 5,128,416	L6769P	probably damaging	Het
Tas2r107	A	T	6: 131,659,489	V199D	possibly damaging	Het
Tchp	A	G	5: 114,720,015		probably null	Het
Trio	G	T	15: 27,854,996	T700K	probably benign	Het
Ttn	C	T	2: 76,755,898	V20084I	probably benign	Het
Ubl3	A	T	5: 148,509,306	Y62*	probably null	Het
Uckl1	A	G	2: 181,573,260	Y267H	possibly damaging	Het
Zfp786	T	C	6: 47,826,986	N41D	probably damaging	Het
Zfp983	T	C	17: 21,662,085	S310P	probably damaging	Het

Other mutations in Trdn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Trdn	APN	10	33471606	critical splice donor site	probably null
IGL01310:Trdn	APN	10	33305098	splice site	probably benign
IGL01313:Trdn	APN	10	33200220	missense	probably damaging	1.00
IGL02177:Trdn	APN	10	33139173	missense	probably damaging	1.00
IGL02631:Trdn	APN	10	33363976	critical splice acceptor site	probably null
IGL02732:Trdn	APN	10	33468199	splice site	probably null
IGL03131:Trdn	APN	10	33398414	nonsense	probably null
Button	UTSW	10	33474453	missense	probably damaging	0.97
R0463:Trdn	UTSW	10	33466421	critical splice acceptor site	probably null
R0610:Trdn	UTSW	10	33474453	missense	probably damaging	0.97
R0786:Trdn	UTSW	10	33305081	missense	probably benign	0.22
R0827:Trdn	UTSW	10	33399158	splice site	probably benign
R1511:Trdn	UTSW	10	33466452	missense	probably benign	0.18
R1623:Trdn	UTSW	10	33258102	missense	possibly damaging	0.82
R1760:Trdn	UTSW	10	33233887	missense	possibly damaging	0.92
R1766:Trdn	UTSW	10	33364008	missense	probably damaging	1.00
R1884:Trdn	UTSW	10	33257095	missense	probably benign	0.38
R2297:Trdn	UTSW	10	33335012	missense	probably damaging	1.00
R2396:Trdn	UTSW	10	33195982	missense	probably damaging	1.00
R3436:Trdn	UTSW	10	33468195	critical splice donor site	probably null
R3686:Trdn	UTSW	10	33468189	missense	probably benign	0.20
R3696:Trdn	UTSW	10	33305032	splice site	probably null
R3701:Trdn	UTSW	10	33334984	missense	probably damaging	0.99
R3712:Trdn	UTSW	10	33157166	missense	probably benign	0.03
R4062:Trdn	UTSW	10	33257087	missense	probably benign	0.05
R4249:Trdn	UTSW	10	33450998	missense	probably benign	0.09
R4289:Trdn	UTSW	10	33464582	missense	probably benign	0.00
R4646:Trdn	UTSW	10	33195981	nonsense	probably null
R4647:Trdn	UTSW	10	33195981	nonsense	probably null
R4648:Trdn	UTSW	10	33195981	nonsense	probably null
R4766:Trdn	UTSW	10	33474506	missense	probably benign	0.04
R4776:Trdn	UTSW	10	33399082	splice site	probably null
R4880:Trdn	UTSW	10	33471579	missense	probably benign	0.26
R4898:Trdn	UTSW	10	33474417	missense	probably damaging	0.96
R5017:Trdn	UTSW	10	33468159	missense	probably benign	0.05
R5300:Trdn	UTSW	10	33195982	missense	probably damaging	1.00
R5320:Trdn	UTSW	10	33333251	critical splice donor site	probably null
R6089:Trdn	UTSW	10	33464575	missense	probably benign	0.01
R6216:Trdn	UTSW	10	33305069	missense	probably damaging	1.00
R6431:Trdn	UTSW	10	33139114	missense	probably damaging	1.00
R6475:Trdn	UTSW	10	33464555	splice site	probably null
R6501:Trdn	UTSW	10	33466454	missense	probably benign	0.02
R6709:Trdn	UTSW	10	33464591	missense	probably benign	0.00
R6783:Trdn	UTSW	10	33438815	missense	probably damaging	0.96
R6906:Trdn	UTSW	10	33233948	missense	probably benign
R6916:Trdn	UTSW	10	33157018	missense	probably damaging	1.00
R7291:Trdn	UTSW	10	33437736	missense	probably null	0.83
R7499:Trdn	UTSW	10	33196101	missense	probably benign
R7601:Trdn	UTSW	10	33196156	missense	probably benign	0.00
R7743:Trdn	UTSW	10	33257062	nonsense	probably null
R8114:Trdn	UTSW	10	33083628	start gained	probably benign
R8220:Trdn	UTSW	10	33450985	missense	possibly damaging	0.57
R8228:Trdn	UTSW	10	33157018	missense	probably damaging	1.00
R8329:Trdn	UTSW	10	33444078	splice site	probably null
R8918:Trdn	UTSW	10	33139121	missense	probably benign	0.33
R9304:Trdn	UTSW	10	33305091	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTACAGTTCTCTTCAGTAGTCAGGG -3'
(R):5'- ATGTCATCTCTTTATGCCAGGC -3'

Sequencing Primer
(F):5'- TGTACAGCATCAGTGAGCCTACTG -3'
(R):5'- GTCATCTCTTTATGCCAGGCAAAATG -3'

Posted On

2018-07-24