Incidental Mutation 'R6662:Rassf9'
ID528029
Institutional Source Beutler Lab
Gene Symbol Rassf9
Ensembl Gene ENSMUSG00000044921
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 9
SynonymsPamci
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6662 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location102512222-102549736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102546038 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 425 (L425Q)
Ref Sequence ENSEMBL: ENSMUSP00000054767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055355] [ENSMUST00000219445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055355
AA Change: L425Q

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054767
Gene: ENSMUSG00000044921
AA Change: L425Q

DomainStartEndE-ValueType
RA 23 119 5.33e-18 SMART
coiled coil region 261 291 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219445
AA Change: L427Q

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to perinuclear endosomes. This protein associates with peptidylglycine alpha-amidating monooxygenase, and may be involved with the trafficking of this enzyme through secretory or endosomal pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit premature lethality, alopecia, lung defects, and abnormal skin morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Rassf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Rassf9 APN 10 102545633 missense probably benign 0.04
IGL02396:Rassf9 APN 10 102545693 missense possibly damaging 0.74
IGL02714:Rassf9 APN 10 102512563 missense possibly damaging 0.85
IGL02987:Rassf9 APN 10 102545248 missense possibly damaging 0.60
IGL03376:Rassf9 APN 10 102545198 missense probably damaging 0.96
R0372:Rassf9 UTSW 10 102546011 missense possibly damaging 0.71
R0377:Rassf9 UTSW 10 102545649 missense probably benign 0.00
R1260:Rassf9 UTSW 10 102512585 critical splice donor site probably null
R1481:Rassf9 UTSW 10 102546034 missense probably benign 0.01
R1563:Rassf9 UTSW 10 102544960 missense probably damaging 0.97
R1894:Rassf9 UTSW 10 102544894 missense possibly damaging 0.92
R1913:Rassf9 UTSW 10 102544939 missense probably benign 0.04
R2115:Rassf9 UTSW 10 102544945 missense probably benign 0.02
R3149:Rassf9 UTSW 10 102544826 missense possibly damaging 0.85
R5072:Rassf9 UTSW 10 102545905 missense probably damaging 0.98
R5282:Rassf9 UTSW 10 102545344 missense probably damaging 1.00
R5804:Rassf9 UTSW 10 102545044 missense probably damaging 1.00
R6296:Rassf9 UTSW 10 102545753 missense probably damaging 1.00
R7719:Rassf9 UTSW 10 102545600 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGCCAAGGAGTTCAGCTCAC -3'
(R):5'- CGCTTGAACCTATCATAAAGTTGG -3'

Sequencing Primer
(F):5'- GGAGTTCAGCTCACTTCACATTAG -3'
(R):5'- GGTGGCCACTAGTTTTTATTAA -3'
Posted On2018-07-24