Incidental Mutation 'R6662:Aldh3a1'
ID528030
Institutional Source Beutler Lab
Gene Symbol Aldh3a1
Ensembl Gene ENSMUSG00000019102
Gene Namealdehyde dehydrogenase family 3, subfamily A1
SynonymsAhd4, Ahd-4, Aldh3, Aldh
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6662 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location61207537-61218421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61214655 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 196 (V196I)
Ref Sequence ENSEMBL: ENSMUSP00000104356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019246] [ENSMUST00000108716] [ENSMUST00000147792]
Predicted Effect probably benign
Transcript: ENSMUST00000019246
AA Change: V196I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000019246
Gene: ENSMUSG00000019102
AA Change: V196I

DomainStartEndE-ValueType
Pfam:Aldedh 1 428 3.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108716
AA Change: V196I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104356
Gene: ENSMUSG00000019102
AA Change: V196I

DomainStartEndE-ValueType
Pfam:Aldedh 1 428 4.1e-98 PFAM
Pfam:LuxC 4 389 9.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147792
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde dehydrogenases oxidize various aldehydes to the corresponding acids. They are involved in the detoxification of alcohol-derived acetaldehyde and in the metabolism of corticosteroids, biogenic amines, neurotransmitters, and lipid peroxidation. The enzyme encoded by this gene forms a cytoplasmic homodimer that preferentially oxidizes aromatic and medium-chain (6 carbons or more) saturated and unsaturated aldehyde substrates. It is thought to promote resistance to UV and 4-hydroxy-2-nonenal-induced oxidative damage in the cornea. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Aldh3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Aldh3a1 APN 11 61213596 missense probably damaging 1.00
IGL00833:Aldh3a1 APN 11 61217180 missense probably damaging 0.99
IGL02281:Aldh3a1 APN 11 61217123 unclassified probably null
IGL02608:Aldh3a1 APN 11 61216321 missense probably damaging 1.00
IGL03294:Aldh3a1 APN 11 61214722 missense probably damaging 1.00
R0006:Aldh3a1 UTSW 11 61217101 missense probably damaging 1.00
R0453:Aldh3a1 UTSW 11 61215512 missense probably benign 0.01
R0612:Aldh3a1 UTSW 11 61214619 missense probably damaging 1.00
R0637:Aldh3a1 UTSW 11 61215478 unclassified probably benign
R1613:Aldh3a1 UTSW 11 61214551 missense probably damaging 0.98
R3423:Aldh3a1 UTSW 11 61215536 missense probably damaging 1.00
R3772:Aldh3a1 UTSW 11 61214605 missense possibly damaging 0.86
R4673:Aldh3a1 UTSW 11 61213494 missense probably benign
R4997:Aldh3a1 UTSW 11 61212311 missense probably benign 0.02
R5425:Aldh3a1 UTSW 11 61213581 missense probably benign 0.01
R5514:Aldh3a1 UTSW 11 61218041 missense probably damaging 1.00
R5679:Aldh3a1 UTSW 11 61217168 missense probably benign 0.00
R6150:Aldh3a1 UTSW 11 61213508 missense probably benign
R6986:Aldh3a1 UTSW 11 61214251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCATGTAAGAGCTGAGG -3'
(R):5'- GCCATAAAACTTGATACCATCATGG -3'

Sequencing Primer
(F):5'- GCAGCCAGTCTCCCATTG -3'
(R):5'- CCATCATGGTAGTAGCAAGGTAG -3'
Posted On2018-07-24