Incidental Mutation 'R6662:Acox1'
ID 528031
Institutional Source Beutler Lab
Gene Symbol Acox1
Ensembl Gene ENSMUSG00000020777
Gene Name acyl-Coenzyme A oxidase 1, palmitoyl
Synonyms AOX, Acyl-CoA oxidase, D130055E20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 116171888-116199045 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116175323 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 418 (Y418H)
Ref Sequence ENSEMBL: ENSMUSP00000122185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066587] [ENSMUST00000072948] [ENSMUST00000148601]
AlphaFold Q9R0H0
Predicted Effect probably damaging
Transcript: ENSMUST00000066587
AA Change: Y454H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063325
Gene: ENSMUSG00000020777
AA Change: Y454H

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 15 133 4.4e-39 PFAM
Pfam:Acyl-CoA_dh_M 135 245 3e-13 PFAM
SCOP:d1is2a1 272 460 1e-43 SMART
Pfam:ACOX 479 659 6.4e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072948
AA Change: Y454H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072717
Gene: ENSMUSG00000020777
AA Change: Y454H

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 15 133 6.8e-38 PFAM
Pfam:Acyl-CoA_dh_M 135 195 1.3e-8 PFAM
SCOP:d1is2a1 272 460 9e-44 SMART
Pfam:ACOX 476 661 4.4e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130229
Predicted Effect probably damaging
Transcript: ENSMUST00000148601
AA Change: Y418H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122185
Gene: ENSMUSG00000020777
AA Change: Y418H

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 48 97 9.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 99 159 7.3e-9 PFAM
SCOP:d1is2a1 236 424 4e-44 SMART
Pfam:ACOX 440 625 1.7e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150549
Meta Mutation Damage Score 0.7760 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a member of the acyl-coenzyme A oxidase family. The encoded protein is localized to peroxisomes and is the first enzyme of the fatty acid beta-oxidation pathway, which catalyzes the desaturation of acyl-coenzyme A to 2-trans-enoyl-coenzyme A. Disruption of this gene results in microvesicular steatohepatitis, spontaneous peroxisome proliferation, and the eventual development of hepatocellular carcinomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a targeted mutation that inactivates the gene show growth retardation, infertility, excess very long chain fatty acids in the blood, and progressive liver disease, including hepatomegaly, and hepatic adenomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Acox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Acox1 APN 11 116174505 splice site probably benign
IGL02096:Acox1 APN 11 116178198 missense probably damaging 0.99
IGL03128:Acox1 APN 11 116182003 missense probably damaging 1.00
R0535:Acox1 UTSW 11 116174438 missense possibly damaging 0.73
R1718:Acox1 UTSW 11 116174682 nonsense probably null
R1728:Acox1 UTSW 11 116198283 splice site probably null
R1971:Acox1 UTSW 11 116198261 missense probably benign 0.05
R3770:Acox1 UTSW 11 116174387 missense probably damaging 1.00
R4347:Acox1 UTSW 11 116198661 missense probably benign 0.03
R4836:Acox1 UTSW 11 116175326 missense probably benign 0.05
R5551:Acox1 UTSW 11 116189491 missense possibly damaging 0.73
R6685:Acox1 UTSW 11 116180348 nonsense probably null
R7453:Acox1 UTSW 11 116180961 missense probably benign 0.41
R7468:Acox1 UTSW 11 116178175 missense possibly damaging 0.87
R7750:Acox1 UTSW 11 116183580 missense possibly damaging 0.51
R8346:Acox1 UTSW 11 116178273 missense possibly damaging 0.74
R8798:Acox1 UTSW 11 116174357 missense probably damaging 1.00
R8944:Acox1 UTSW 11 116175214 missense probably damaging 1.00
R9058:Acox1 UTSW 11 116189442 missense possibly damaging 0.75
R9164:Acox1 UTSW 11 116198347 missense probably benign 0.03
R9189:Acox1 UTSW 11 116174405 missense probably damaging 1.00
R9373:Acox1 UTSW 11 116174347 missense possibly damaging 0.91
Z1177:Acox1 UTSW 11 116175063 missense probably benign 0.00
Z1177:Acox1 UTSW 11 116175065 missense probably benign 0.00
Z1177:Acox1 UTSW 11 116183545 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGAGAAACCCATGGTTCTCAC -3'
(R):5'- TGACTCTAGCTGTATCAAGTTGAC -3'

Sequencing Primer
(F):5'- ATGGTTCTCACAGCTGACCTGG -3'
(R):5'- CATGAATTTAGCCAGGATAGCAC -3'
Posted On 2018-07-24