Incidental Mutation 'R6662:Trio'
ID 528035
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Name triple functional domain (PTPRF interacting)
Synonyms Solo, 6720464I07Rik
MMRRC Submission 044782-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 27730651-28025848 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 27854996 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 700 (T700K)
Ref Sequence ENSEMBL: ENSMUSP00000154653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000227337]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000090247
AA Change: T759K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: T759K

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226580
Predicted Effect probably benign
Transcript: ENSMUST00000227337
AA Change: T700K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228765
Meta Mutation Damage Score 0.0969 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 (GRCm38) probably null Het
Acox1 A G 11: 116,175,323 (GRCm38) Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 (GRCm38) V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 (GRCm38) V196I probably benign Het
Aox3 A G 1: 58,118,615 (GRCm38) K44E probably damaging Het
Bad T A 19: 6,951,070 (GRCm38) probably benign Het
BC034090 G T 1: 155,226,339 (GRCm38) Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 (GRCm38) T181A probably benign Het
Catsperg2 G A 7: 29,719,513 (GRCm38) probably benign Het
Ccdc14 T C 16: 34,690,794 (GRCm38) L46P probably damaging Het
Ces1b A G 8: 93,064,069 (GRCm38) L364S probably benign Het
Cfap45 T C 1: 172,529,850 (GRCm38) I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 (GRCm38) R6M possibly damaging Het
Dph5 G A 3: 115,928,556 (GRCm38) E228K probably benign Het
Fat4 G T 3: 38,956,821 (GRCm38) L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 (GRCm38) N351D probably benign Het
Gm14124 G A 2: 150,266,252 (GRCm38) probably null Het
Grm2 C T 9: 106,648,053 (GRCm38) A488T probably benign Het
Ifit3b A G 19: 34,611,937 (GRCm38) E171G probably damaging Het
Il1rn A T 2: 24,336,875 (GRCm38) probably null Het
Itih5 A T 2: 10,249,181 (GRCm38) I748F probably benign Het
Kcnh5 C A 12: 75,007,611 (GRCm38) D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 (GRCm38) H574N probably damaging Het
Moxd1 A C 10: 24,284,760 (GRCm38) D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 (GRCm38) F888L probably benign Het
Ncs1 T A 2: 31,287,360 (GRCm38) L183Q probably damaging Het
Neto2 A T 8: 85,663,215 (GRCm38) D206E probably damaging Het
Omp A G 7: 98,145,339 (GRCm38) L27P probably damaging Het
Oxsm A G 14: 16,242,287 (GRCm38) S161P probably benign Het
Pde4b A G 4: 102,601,898 (GRCm38) I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 (GRCm38) N137K probably benign Het
Prss33 T C 17: 23,833,960 (GRCm38) S247G probably damaging Het
Rassf9 T A 10: 102,546,038 (GRCm38) L425Q possibly damaging Het
Setx A T 2: 29,158,114 (GRCm38) D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 (GRCm38) K402* probably null Het
Slco1a6 G A 6: 142,133,215 (GRCm38) T118I probably damaging Het
Syne1 A G 10: 5,128,416 (GRCm38) L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 (GRCm38) V199D possibly damaging Het
Tchp A G 5: 114,720,015 (GRCm38) probably null Het
Trdn A T 10: 33,474,487 (GRCm38) N684I probably damaging Het
Ttn C T 2: 76,755,898 (GRCm38) V20084I probably benign Het
Ubl3 A T 5: 148,509,306 (GRCm38) Y62* probably null Het
Uckl1 A G 2: 181,573,260 (GRCm38) Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 (GRCm38) N41D probably damaging Het
Zfp983 T C 17: 21,662,085 (GRCm38) S310P probably damaging Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27,912,743 (GRCm38) splice site probably benign
IGL01011:Trio APN 15 27,736,489 (GRCm38) missense probably damaging 0.96
IGL01090:Trio APN 15 27,773,007 (GRCm38) missense probably damaging 1.00
IGL01145:Trio APN 15 27,818,167 (GRCm38) splice site probably benign
IGL01147:Trio APN 15 27,881,320 (GRCm38) missense probably damaging 1.00
IGL01161:Trio APN 15 27,749,781 (GRCm38) missense probably damaging 1.00
IGL01324:Trio APN 15 27,905,323 (GRCm38) missense probably benign 0.42
IGL01352:Trio APN 15 27,901,229 (GRCm38) missense probably benign 0.01
IGL01366:Trio APN 15 27,732,868 (GRCm38) missense possibly damaging 0.76
IGL01443:Trio APN 15 27,838,775 (GRCm38) splice site probably benign
IGL01454:Trio APN 15 27,832,985 (GRCm38) missense probably benign 0.32
IGL01695:Trio APN 15 27,773,001 (GRCm38) missense probably damaging 1.00
IGL01765:Trio APN 15 27,764,026 (GRCm38) missense possibly damaging 0.85
IGL01860:Trio APN 15 27,846,810 (GRCm38) missense probably damaging 1.00
IGL01879:Trio APN 15 27,741,033 (GRCm38) missense probably benign 0.12
IGL01991:Trio APN 15 27,871,274 (GRCm38) missense possibly damaging 0.95
IGL02106:Trio APN 15 27,744,158 (GRCm38) missense possibly damaging 0.85
IGL02209:Trio APN 15 27,744,053 (GRCm38) missense probably damaging 1.00
IGL02232:Trio APN 15 27,902,561 (GRCm38) missense probably benign 0.24
IGL02304:Trio APN 15 27,735,436 (GRCm38) missense probably damaging 0.96
IGL02504:Trio APN 15 27,847,390 (GRCm38) nonsense probably null
IGL02508:Trio APN 15 27,818,104 (GRCm38) missense possibly damaging 0.65
IGL02541:Trio APN 15 27,844,930 (GRCm38) splice site probably benign
IGL02617:Trio APN 15 27,841,849 (GRCm38) splice site probably benign
IGL02675:Trio APN 15 27,768,039 (GRCm38) unclassified probably benign
IGL02817:Trio APN 15 27,902,881 (GRCm38) missense probably benign 0.01
IGL02993:Trio APN 15 27,830,239 (GRCm38) splice site probably benign
IGL03007:Trio APN 15 27,902,742 (GRCm38) missense probably damaging 0.99
IGL03135:Trio APN 15 27,832,011 (GRCm38) splice site probably benign
IGL03225:Trio APN 15 27,902,695 (GRCm38) missense probably benign 0.30
R0063:Trio UTSW 15 27,881,437 (GRCm38) splice site probably benign
R0063:Trio UTSW 15 27,881,437 (GRCm38) splice site probably benign
R0302:Trio UTSW 15 27,902,517 (GRCm38) missense probably damaging 1.00
R0505:Trio UTSW 15 27,767,907 (GRCm38) missense probably benign 0.00
R0506:Trio UTSW 15 27,854,963 (GRCm38) missense probably benign 0.12
R0564:Trio UTSW 15 27,805,822 (GRCm38) missense probably damaging 1.00
R0659:Trio UTSW 15 27,831,399 (GRCm38) missense probably damaging 0.97
R0882:Trio UTSW 15 27,732,894 (GRCm38) missense probably damaging 1.00
R0939:Trio UTSW 15 27,741,250 (GRCm38) critical splice donor site probably null
R1018:Trio UTSW 15 27,871,171 (GRCm38) missense probably damaging 1.00
R1439:Trio UTSW 15 27,897,914 (GRCm38) missense probably damaging 1.00
R1456:Trio UTSW 15 27,753,804 (GRCm38) splice site probably benign
R1488:Trio UTSW 15 27,740,967 (GRCm38) missense probably damaging 1.00
R1522:Trio UTSW 15 27,732,640 (GRCm38) missense probably benign 0.28
R1531:Trio UTSW 15 27,832,985 (GRCm38) missense probably benign 0.32
R1640:Trio UTSW 15 27,833,044 (GRCm38) missense probably damaging 1.00
R1646:Trio UTSW 15 27,758,347 (GRCm38) missense possibly damaging 0.91
R1682:Trio UTSW 15 27,744,146 (GRCm38) splice site probably null
R1780:Trio UTSW 15 27,744,038 (GRCm38) missense possibly damaging 0.93
R1791:Trio UTSW 15 27,841,756 (GRCm38) missense probably damaging 1.00
R1803:Trio UTSW 15 27,748,340 (GRCm38) missense probably benign
R1817:Trio UTSW 15 27,742,495 (GRCm38) nonsense probably null
R1853:Trio UTSW 15 27,756,536 (GRCm38) missense probably damaging 1.00
R1898:Trio UTSW 15 27,742,380 (GRCm38) missense possibly damaging 0.52
R1937:Trio UTSW 15 27,833,056 (GRCm38) missense probably damaging 1.00
R1938:Trio UTSW 15 27,732,891 (GRCm38) missense probably damaging 0.98
R2025:Trio UTSW 15 27,773,927 (GRCm38) missense probably damaging 1.00
R2025:Trio UTSW 15 27,744,137 (GRCm38) missense probably damaging 0.99
R2050:Trio UTSW 15 27,851,945 (GRCm38) missense possibly damaging 0.85
R2186:Trio UTSW 15 27,823,975 (GRCm38) splice site probably null
R2913:Trio UTSW 15 27,854,912 (GRCm38) missense probably damaging 1.00
R3151:Trio UTSW 15 27,805,776 (GRCm38) missense probably damaging 1.00
R3771:Trio UTSW 15 27,748,091 (GRCm38) missense probably damaging 0.98
R3773:Trio UTSW 15 27,748,091 (GRCm38) missense probably damaging 0.98
R3826:Trio UTSW 15 27,833,070 (GRCm38) missense probably damaging 1.00
R4015:Trio UTSW 15 27,744,101 (GRCm38) missense possibly damaging 0.71
R4359:Trio UTSW 15 27,749,797 (GRCm38) nonsense probably null
R4370:Trio UTSW 15 27,748,337 (GRCm38) nonsense probably null
R4547:Trio UTSW 15 27,818,982 (GRCm38) missense possibly damaging 0.89
R4573:Trio UTSW 15 27,772,998 (GRCm38) small deletion probably benign
R4620:Trio UTSW 15 27,871,171 (GRCm38) missense probably damaging 1.00
R4735:Trio UTSW 15 27,752,789 (GRCm38) splice site probably null
R4764:Trio UTSW 15 27,732,538 (GRCm38) nonsense probably null
R4775:Trio UTSW 15 27,881,342 (GRCm38) nonsense probably null
R4942:Trio UTSW 15 27,752,725 (GRCm38) missense probably benign 0.21
R5004:Trio UTSW 15 27,755,178 (GRCm38) missense probably damaging 1.00
R5149:Trio UTSW 15 27,754,029 (GRCm38) missense possibly damaging 0.74
R5183:Trio UTSW 15 27,902,600 (GRCm38) missense probably benign 0.00
R5186:Trio UTSW 15 27,897,991 (GRCm38) missense probably damaging 0.97
R5268:Trio UTSW 15 27,748,286 (GRCm38) missense probably benign 0.02
R5344:Trio UTSW 15 27,735,532 (GRCm38) missense probably benign 0.12
R5407:Trio UTSW 15 27,844,806 (GRCm38) splice site probably null
R5442:Trio UTSW 15 27,856,194 (GRCm38) missense probably benign 0.04
R5617:Trio UTSW 15 27,902,748 (GRCm38) missense probably benign
R5778:Trio UTSW 15 27,856,164 (GRCm38) missense probably benign 0.33
R5986:Trio UTSW 15 27,851,933 (GRCm38) missense possibly damaging 0.88
R5990:Trio UTSW 15 27,891,459 (GRCm38) missense probably benign 0.10
R6011:Trio UTSW 15 27,735,545 (GRCm38) missense probably damaging 0.98
R6063:Trio UTSW 15 27,891,379 (GRCm38) missense possibly damaging 0.94
R6166:Trio UTSW 15 27,818,071 (GRCm38) missense probably damaging 0.96
R6187:Trio UTSW 15 27,743,952 (GRCm38) critical splice donor site probably null
R6387:Trio UTSW 15 27,752,739 (GRCm38) missense probably damaging 1.00
R6402:Trio UTSW 15 27,902,911 (GRCm38) missense probably benign 0.02
R6478:Trio UTSW 15 27,856,107 (GRCm38) missense probably benign 0.01
R6528:Trio UTSW 15 27,805,870 (GRCm38) missense probably damaging 1.00
R6825:Trio UTSW 15 27,889,308 (GRCm38) missense probably damaging 0.98
R6890:Trio UTSW 15 27,919,288 (GRCm38) unclassified probably benign
R6945:Trio UTSW 15 27,824,090 (GRCm38) missense probably damaging 1.00
R7027:Trio UTSW 15 27,805,654 (GRCm38) missense possibly damaging 0.86
R7046:Trio UTSW 15 27,832,051 (GRCm38) missense probably damaging 1.00
R7049:Trio UTSW 15 27,749,799 (GRCm38) missense possibly damaging 0.66
R7075:Trio UTSW 15 27,898,000 (GRCm38) missense unknown
R7094:Trio UTSW 15 27,891,448 (GRCm38) missense unknown
R7123:Trio UTSW 15 27,742,313 (GRCm38) critical splice donor site probably benign
R7130:Trio UTSW 15 27,742,313 (GRCm38) critical splice donor site probably benign
R7214:Trio UTSW 15 27,871,187 (GRCm38) missense probably damaging 0.97
R7292:Trio UTSW 15 27,828,351 (GRCm38) missense possibly damaging 0.63
R7293:Trio UTSW 15 27,871,289 (GRCm38) missense possibly damaging 0.66
R7352:Trio UTSW 15 27,732,876 (GRCm38) missense probably damaging 0.96
R7426:Trio UTSW 15 27,856,107 (GRCm38) missense probably benign 0.01
R7451:Trio UTSW 15 27,747,913 (GRCm38) missense probably benign 0.07
R7558:Trio UTSW 15 27,831,394 (GRCm38) missense possibly damaging 0.90
R7578:Trio UTSW 15 27,854,939 (GRCm38) missense possibly damaging 0.94
R7596:Trio UTSW 15 27,749,826 (GRCm38) missense probably damaging 0.99
R7604:Trio UTSW 15 27,736,445 (GRCm38) critical splice donor site probably null
R7609:Trio UTSW 15 27,912,642 (GRCm38) missense unknown
R7767:Trio UTSW 15 27,889,418 (GRCm38) missense unknown
R7784:Trio UTSW 15 27,763,994 (GRCm38) missense probably damaging 1.00
R7817:Trio UTSW 15 27,749,866 (GRCm38) missense probably benign 0.35
R7833:Trio UTSW 15 27,774,086 (GRCm38) missense probably damaging 0.99
R7873:Trio UTSW 15 27,805,684 (GRCm38) missense possibly damaging 0.83
R7879:Trio UTSW 15 27,851,924 (GRCm38) missense possibly damaging 0.94
R7989:Trio UTSW 15 27,772,935 (GRCm38) missense probably damaging 0.97
R8022:Trio UTSW 15 27,749,866 (GRCm38) missense probably benign 0.35
R8050:Trio UTSW 15 27,891,454 (GRCm38) missense unknown
R8217:Trio UTSW 15 27,818,969 (GRCm38) missense probably damaging 0.97
R8280:Trio UTSW 15 27,902,910 (GRCm38) missense unknown
R8283:Trio UTSW 15 27,756,542 (GRCm38) missense possibly damaging 0.79
R8300:Trio UTSW 15 27,855,022 (GRCm38) missense possibly damaging 0.66
R8321:Trio UTSW 15 27,881,326 (GRCm38) missense possibly damaging 0.90
R8477:Trio UTSW 15 27,773,952 (GRCm38) missense possibly damaging 0.83
R8479:Trio UTSW 15 27,901,200 (GRCm38) missense probably benign 0.25
R8682:Trio UTSW 15 27,905,192 (GRCm38) missense unknown
R8688:Trio UTSW 15 27,748,238 (GRCm38) missense possibly damaging 0.61
R8708:Trio UTSW 15 27,732,546 (GRCm38) missense probably damaging 0.99
R8709:Trio UTSW 15 27,919,237 (GRCm38) missense unknown
R8713:Trio UTSW 15 27,743,951 (GRCm38) critical splice donor site probably benign
R8798:Trio UTSW 15 27,851,837 (GRCm38) missense possibly damaging 0.92
R8812:Trio UTSW 15 27,905,225 (GRCm38) missense unknown
R8816:Trio UTSW 15 27,741,271 (GRCm38) missense probably damaging 0.96
R8828:Trio UTSW 15 27,741,064 (GRCm38) missense possibly damaging 0.93
R8987:Trio UTSW 15 27,732,687 (GRCm38) missense probably benign 0.23
R9051:Trio UTSW 15 27,732,684 (GRCm38) missense possibly damaging 0.78
R9069:Trio UTSW 15 27,852,011 (GRCm38) missense possibly damaging 0.83
R9075:Trio UTSW 15 27,773,936 (GRCm38) nonsense probably null
R9079:Trio UTSW 15 27,732,937 (GRCm38) missense possibly damaging 0.52
R9139:Trio UTSW 15 27,749,836 (GRCm38) nonsense probably null
R9494:Trio UTSW 15 27,846,757 (GRCm38) missense probably benign 0.00
R9680:Trio UTSW 15 27,744,072 (GRCm38) missense possibly damaging 0.93
R9720:Trio UTSW 15 27,847,409 (GRCm38) missense probably benign 0.00
R9726:Trio UTSW 15 27,912,666 (GRCm38) missense unknown
X0024:Trio UTSW 15 27,765,726 (GRCm38) missense possibly damaging 0.91
Z1176:Trio UTSW 15 27,771,387 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCCTTGCTTGGTAGAGGC -3'
(R):5'- CTGAGACAAAGTCCAGCTTCC -3'

Sequencing Primer
(F):5'- GCTTGGTAGAGGCGCAGG -3'
(R):5'- AAGTCCAGCTTCCTGCCAG -3'
Posted On 2018-07-24