Incidental Mutation 'R6662:Ccdc14'
ID 528036
Institutional Source Beutler Lab
Gene Symbol Ccdc14
Ensembl Gene ENSMUSG00000022833
Gene Name coiled-coil domain containing 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 34690616-34725202 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34690794 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 46 (L46P)
Ref Sequence ENSEMBL: ENSMUSP00000023532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023532] [ENSMUST00000231609]
AlphaFold Q8K2J4
Predicted Effect probably damaging
Transcript: ENSMUST00000023532
AA Change: L46P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023532
Gene: ENSMUSG00000022833
AA Change: L46P

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:CCDC14 96 934 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231364
Predicted Effect probably benign
Transcript: ENSMUST00000231609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232489
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Ccdc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Ccdc14 APN 16 34723213 missense probably damaging 1.00
IGL02338:Ccdc14 APN 16 34721803 missense probably benign 0.00
IGL02494:Ccdc14 APN 16 34723414 missense probably damaging 1.00
IGL02648:Ccdc14 APN 16 34697158 missense probably damaging 1.00
R0632:Ccdc14 UTSW 16 34721649 missense possibly damaging 0.86
R1199:Ccdc14 UTSW 16 34723828 missense probably damaging 1.00
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R2012:Ccdc14 UTSW 16 34690722 missense possibly damaging 0.83
R2087:Ccdc14 UTSW 16 34695645 critical splice donor site probably null
R2337:Ccdc14 UTSW 16 34705018 missense probably benign 0.04
R2504:Ccdc14 UTSW 16 34721850 nonsense probably null
R3155:Ccdc14 UTSW 16 34723852 missense probably damaging 1.00
R4618:Ccdc14 UTSW 16 34706495 missense probably benign 0.08
R4645:Ccdc14 UTSW 16 34721740 missense probably damaging 1.00
R4835:Ccdc14 UTSW 16 34705038 missense probably damaging 1.00
R5186:Ccdc14 UTSW 16 34721585 missense probably damaging 1.00
R5214:Ccdc14 UTSW 16 34704855 missense probably benign 0.24
R5319:Ccdc14 UTSW 16 34723172 missense probably damaging 0.99
R5921:Ccdc14 UTSW 16 34706391 missense probably damaging 0.99
R5945:Ccdc14 UTSW 16 34723588 missense probably damaging 1.00
R6141:Ccdc14 UTSW 16 34706562 missense probably damaging 1.00
R6925:Ccdc14 UTSW 16 34690749 missense probably benign 0.29
R6958:Ccdc14 UTSW 16 34690806 missense probably damaging 1.00
R6970:Ccdc14 UTSW 16 34709533 missense probably damaging 1.00
R7365:Ccdc14 UTSW 16 34723619 nonsense probably null
R7845:Ccdc14 UTSW 16 34715364 missense probably damaging 1.00
R7889:Ccdc14 UTSW 16 34723836 missense probably damaging 1.00
R7903:Ccdc14 UTSW 16 34704910 missense probably damaging 0.99
R8093:Ccdc14 UTSW 16 34709652 missense probably damaging 1.00
R8207:Ccdc14 UTSW 16 34705043 missense possibly damaging 0.62
R8368:Ccdc14 UTSW 16 34723372 missense probably benign 0.00
R9060:Ccdc14 UTSW 16 34697116 missense probably benign 0.41
R9128:Ccdc14 UTSW 16 34706789 missense probably damaging 1.00
R9163:Ccdc14 UTSW 16 34690748 missense possibly damaging 0.93
R9294:Ccdc14 UTSW 16 34697358 missense probably damaging 0.99
R9318:Ccdc14 UTSW 16 34704918 missense possibly damaging 0.90
Z1088:Ccdc14 UTSW 16 34690804 start codon destroyed probably null 0.98
Z1176:Ccdc14 UTSW 16 34706498 missense probably damaging 1.00
Z1177:Ccdc14 UTSW 16 34723670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAAGGAAAACCTTTTAGCGC -3'
(R):5'- GCACAATTGCTGGATAACTACG -3'

Sequencing Primer
(F):5'- ACCTTTTAGCGCCAAGGAG -3'
(R):5'- TCACTGCACTGGTGATAAAGGC -3'
Posted On 2018-07-24