Incidental Mutation 'R6662:Zfp983'
ID 528037
Institutional Source Beutler Lab
Gene Symbol Zfp983
Ensembl Gene ENSMUSG00000035868
Gene Name zinc finger protein 983
Synonyms 3110052M02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 21657582-21662540 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21662085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 310 (S310P)
Ref Sequence ENSEMBL: ENSMUSP00000039392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039726]
AlphaFold E9PUT0
Predicted Effect probably damaging
Transcript: ENSMUST00000039726
AA Change: S310P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039392
Gene: ENSMUSG00000035868
AA Change: S310P

DomainStartEndE-ValueType
KRAB 13 73 2.42e-22 SMART
ZnF_C2H2 185 207 5.5e-3 SMART
ZnF_C2H2 213 235 5.14e-3 SMART
ZnF_C2H2 241 263 4.54e-4 SMART
ZnF_C2H2 269 291 7.9e-4 SMART
ZnF_C2H2 297 319 2.86e-1 SMART
ZnF_C2H2 325 347 6.88e-4 SMART
ZnF_C2H2 353 375 1.95e-3 SMART
ZnF_C2H2 381 403 1.04e-3 SMART
ZnF_C2H2 409 431 2.79e-4 SMART
ZnF_C2H2 437 459 3.63e-3 SMART
Meta Mutation Damage Score 0.6536 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Other mutations in Zfp983
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Zfp983 APN 17 21657612 critical splice donor site probably null
IGL02492:Zfp983 APN 17 21657612 critical splice donor site probably null
IGL03145:Zfp983 APN 17 21659008 missense probably damaging 0.99
R0257:Zfp983 UTSW 17 21661440 missense probably benign 0.35
R1518:Zfp983 UTSW 17 21662353 missense probably damaging 1.00
R1925:Zfp983 UTSW 17 21662017 missense probably damaging 1.00
R2504:Zfp983 UTSW 17 21658967 missense probably damaging 1.00
R3701:Zfp983 UTSW 17 21661539 missense probably damaging 1.00
R4308:Zfp983 UTSW 17 21662208 missense probably benign 0.05
R5648:Zfp983 UTSW 17 21659031 missense probably damaging 1.00
R6029:Zfp983 UTSW 17 21662485 missense probably benign 0.03
R6188:Zfp983 UTSW 17 21659019 missense probably damaging 1.00
R7313:Zfp983 UTSW 17 21661497 missense probably damaging 0.97
R7361:Zfp983 UTSW 17 21661934 missense probably damaging 1.00
R8710:Zfp983 UTSW 17 21661318 missense probably damaging 0.99
R9153:Zfp983 UTSW 17 21657606 missense probably benign 0.08
R9285:Zfp983 UTSW 17 21657604 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AATCCTATAACCGGTGTGCAAA -3'
(R):5'- GAGTAAAGGACTTGTCACATTCCAT -3'

Sequencing Primer
(F):5'- GTGGAAAGTCATTTCGTCAAACCTCC -3'
(R):5'- TGTCACACACCTCACATTTGTAAGG -3'
Posted On 2018-07-24