Mutagenetix > Incidental Mutations

Incidental Mutation 'R6662:Garem1'

528039

Institutional Source

Beutler Lab

Gene Symbol

Garem1

Ensembl Gene

ENSMUSG00000042680

Gene Name

GRB2 associated regulator of MAPK1 subtype 1

Synonyms

Garem, Fam59a, LOC381126

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.187) question?

Stock #

R6662 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21127201-21300138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21148247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 351 (N351D)

Ref Sequence

ENSEMBL: ENSMUSP00000048914 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049260]

AlphaFold

Q3UFT3

Predicted Effect

probably benign
Transcript: ENSMUST00000049260
AA Change: N351D

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: N351D

Domain	Start	End	E-Value	Type
Pfam:CABIT	32	318	3.4e-79	PFAM
low complexity region	484	499	N/A	INTRINSIC
low complexity region	512	518	N/A	INTRINSIC
PDB:2DKZ\|A	795	874	2e-40	PDB
Blast:SAM	808	875	2e-36	BLAST
SCOP:d1kw4a_	812	873	4e-4	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox1	A	G	11: 116,175,323	Y418H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Aldh3a1	G	A	11: 61,214,655	V196I	probably benign	Het
Aox3	A	G	1: 58,118,615	K44E	probably damaging	Het
Bad	T	A	19: 6,951,070		probably benign	Het
BC034090	G	T	1: 155,226,339	Q60K	possibly damaging	Het
Casp6	A	G	3: 129,912,226	T181A	probably benign	Het
Catsperg2	G	A	7: 29,719,513		probably benign	Het
Ccdc14	T	C	16: 34,690,794	L46P	probably damaging	Het
Ces1b	A	G	8: 93,064,069	L364S	probably benign	Het
Cfap45	T	C	1: 172,529,850	I15T	probably benign	Het
D730048I06Rik	C	A	9: 35,790,000	R6M	possibly damaging	Het
Dph5	G	A	3: 115,928,556	E228K	probably benign	Het
Fat4	G	T	3: 38,956,821	L2023F	possibly damaging	Het
Gm14124	G	A	2: 150,266,252		probably null	Het
Grm2	C	T	9: 106,648,053	A488T	probably benign	Het
Ifit3b	A	G	19: 34,611,937	E171G	probably damaging	Het
Il1rn	A	T	2: 24,336,875		probably null	Het
Itih5	A	T	2: 10,249,181	I748F	probably benign	Het
Kcnh5	C	A	12: 75,007,611	D520Y	probably damaging	Het
Mgat5	C	A	1: 127,469,237	H574N	probably damaging	Het
Moxd1	A	C	10: 24,284,760	D437A	probably damaging	Het
Mybpc2	A	G	7: 44,506,166	F888L	probably benign	Het
Ncs1	T	A	2: 31,287,360	L183Q	probably damaging	Het
Neto2	A	T	8: 85,663,215	D206E	probably damaging	Het
Omp	A	G	7: 98,145,339	L27P	probably damaging	Het
Oxsm	A	G	14: 16,242,287	S161P	probably benign	Het
Pde4b	A	G	4: 102,601,898	I381M	possibly damaging	Het
Pramel5	A	T	4: 144,273,105	N137K	probably benign	Het
Prss33	T	C	17: 23,833,960	S247G	probably damaging	Het
Rassf9	T	A	10: 102,546,038	L425Q	possibly damaging	Het
Setx	A	T	2: 29,158,114	D1909V	probably damaging	Het
Slc26a3	A	T	12: 31,457,346	K402*	probably null	Het
Slco1a6	G	A	6: 142,133,215	T118I	probably damaging	Het
Syne1	A	G	10: 5,128,416	L6769P	probably damaging	Het
Tas2r107	A	T	6: 131,659,489	V199D	possibly damaging	Het
Tchp	A	G	5: 114,720,015		probably null	Het
Trdn	A	T	10: 33,474,487	N684I	probably damaging	Het
Trio	G	T	15: 27,854,996	T700K	probably benign	Het
Ttn	C	T	2: 76,755,898	V20084I	probably benign	Het
Ubl3	A	T	5: 148,509,306	Y62*	probably null	Het
Uckl1	A	G	2: 181,573,260	Y267H	possibly damaging	Het
Zfp786	T	C	6: 47,826,986	N41D	probably damaging	Het
Zfp983	T	C	17: 21,662,085	S310P	probably damaging	Het

Other mutations in Garem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Garem1	APN	18	21148657	missense	probably damaging	1.00
IGL01588:Garem1	APN	18	21129797	missense	probably damaging	0.99
IGL02171:Garem1	APN	18	21129241	missense	probably damaging	0.98
IGL02270:Garem1	APN	18	21148450	missense	probably damaging	1.00
IGL03149:Garem1	APN	18	21131466	missense	probably damaging	1.00
R0136:Garem1	UTSW	18	21129991	missense	probably damaging	0.96
R0285:Garem1	UTSW	18	21129612	missense	probably benign
R0361:Garem1	UTSW	18	21299744	nonsense	probably null
R1068:Garem1	UTSW	18	21168755	missense	probably benign	0.00
R1537:Garem1	UTSW	18	21168874	splice site	probably null
R1726:Garem1	UTSW	18	21148262	missense	probably damaging	0.99
R1826:Garem1	UTSW	18	21129452	missense	probably benign	0.00
R2140:Garem1	UTSW	18	21129374	missense	probably damaging	1.00
R3714:Garem1	UTSW	18	21148890	missense	probably damaging	1.00
R3937:Garem1	UTSW	18	21148806	nonsense	probably null
R4362:Garem1	UTSW	18	21236115	missense	possibly damaging	0.62
R4441:Garem1	UTSW	18	21168750	missense	possibly damaging	0.92
R4747:Garem1	UTSW	18	21129943	missense	probably benign
R4814:Garem1	UTSW	18	21148116	missense	probably damaging	1.00
R4831:Garem1	UTSW	18	21129768	missense	probably benign	0.01
R4838:Garem1	UTSW	18	21147893	missense	probably benign	0.00
R5805:Garem1	UTSW	18	21148435	missense	probably benign	0.04
R5963:Garem1	UTSW	18	21129430	missense	probably benign	0.45
R5982:Garem1	UTSW	18	21148351	missense	possibly damaging	0.64
R6134:Garem1	UTSW	18	21129824	missense	probably benign	0.00
R6242:Garem1	UTSW	18	21129172	missense	possibly damaging	0.72
R6453:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6485:Garem1	UTSW	18	21129837	missense	probably benign	0.00
R6596:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6883:Garem1	UTSW	18	21129712	missense	probably benign
R6937:Garem1	UTSW	18	21147770	missense	probably benign	0.00
R7027:Garem1	UTSW	18	21129994	missense	probably benign
R7256:Garem1	UTSW	18	21148754	missense	probably damaging	1.00
R7534:Garem1	UTSW	18	21299916	start gained	probably benign
R7620:Garem1	UTSW	18	21129841	missense	probably benign
R7869:Garem1	UTSW	18	21299700	missense	probably damaging	1.00
R7963:Garem1	UTSW	18	21148787	missense	probably damaging	0.98
R8058:Garem1	UTSW	18	21148564	missense	probably damaging	1.00
R8953:Garem1	UTSW	18	21131331	critical splice donor site	probably null
R9273:Garem1	UTSW	18	21148217	missense	probably damaging	0.99
R9411:Garem1	UTSW	18	21236000
Z1176:Garem1	UTSW	18	21129792	missense	probably damaging	1.00
Z1176:Garem1	UTSW	18	21148325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGCCATGGAGATTCACC -3'
(R):5'- AAGTTTGTGAACATCCAGACCAAG -3'

Sequencing Primer
(F):5'- AGATTCACCTCACTATTGCCATGGAG -3'
(R):5'- TTGTGTGCTGCGCAACAAC -3'

Posted On

2018-07-24