Incidental Mutation 'R6662:Bad'
ID528040
Institutional Source Beutler Lab
Gene Symbol Bad
Ensembl Gene ENSMUSG00000024959
Gene NameBCL2-associated agonist of cell death
SynonymsBbc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6662 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6941861-6951898 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 6951070 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000025910] [ENSMUST00000025912] [ENSMUST00000113423] [ENSMUST00000113426]
Predicted Effect probably benign
Transcript: ENSMUST00000025910
SMART Domains Protein: ENSMUSP00000025910
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 43 204 5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025912
SMART Domains Protein: ENSMUSP00000025912
Gene: ENSMUSG00000024960

DomainStartEndE-ValueType
Pfam:EF-hand_like 225 316 6.6e-23 PFAM
PLCXc 317 468 4.26e-73 SMART
low complexity region 488 515 N/A INTRINSIC
low complexity region 553 578 N/A INTRINSIC
PLCYc 591 707 3.88e-76 SMART
C2 728 826 4.52e-14 SMART
low complexity region 917 936 N/A INTRINSIC
Pfam:PLC-beta_C 1029 1202 5.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113423
SMART Domains Protein: ENSMUSP00000109050
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 162 9.1e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113426
SMART Domains Protein: ENSMUSP00000109053
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 43 172 5.7e-66 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000141410
AA Change: L160Q
SMART Domains Protein: ENSMUSP00000114597
Gene: ENSMUSG00000024959
AA Change: L160Q

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 134 2.9e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145463
SMART Domains Protein: ENSMUSP00000121778
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 51 1.4e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the BCL-2 family. BCL-2 family members are known to be regulators of programmed cell death. This protein positively regulates cell apoptosis by forming heterodimers with BCL-xL and BCL-2, and reversing their death repressor activity. Proapoptotic activity of this protein is regulated through its phosphorylation. Protein kinases AKT and MAP kinase, as well as protein phosphatase calcineurin were found to be involved in the regulation of this protein. Alternative splicing of this gene results in two transcript variants which encode the same isoform. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are grossly normal and fertile. Both T and B cells show increased sensitivity to gamma irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Bad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02426:Bad APN 19 6951417 missense probably damaging 1.00
R3437:Bad UTSW 19 6942431 missense probably benign 0.16
R4419:Bad UTSW 19 6950685 missense probably benign 0.14
R6886:Bad UTSW 19 6951334 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATCTAGGGCATGTCGGGATTTC -3'
(R):5'- CCGGGATCCTAAATGAAACTGC -3'

Sequencing Primer
(F):5'- GGGATTTCTAGTTTCAGAGCCACC -3'
(R):5'- TGCACAGCCAGAGATCTAGTGTTTAG -3'
Posted On2018-07-24