Incidental Mutation 'R6669:Slc30a10'
ID528045
Institutional Source Beutler Lab
Gene Symbol Slc30a10
Ensembl Gene ENSMUSG00000026614
Gene Namesolute carrier family 30, member 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6669 (G1)
Quality Score207.009
Status Validated
Chromosome1
Chromosomal Location185454848-185468762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 185464428 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 429 (R429Q)
Ref Sequence ENSEMBL: ENSMUSP00000053181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061093]
Predicted Effect probably benign
Transcript: ENSMUST00000061093
AA Change: R429Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053181
Gene: ENSMUSG00000026614
AA Change: R429Q

DomainStartEndE-ValueType
Pfam:Cation_efflux 11 299 2e-44 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly expressed in the liver and is inducible by manganese. Its protein product appears to be critical in maintaining manganese levels, and has higher specificity for manganese than zinc. Loss of function mutations appear to result in a pleomorphic phenotype, including dystonia and adult-onset parkinsonism. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit post-weaning growth defects, increased manganese levels in the brain, blood, liver and thyroid gland, severe hypothyroidism and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Slc30a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Slc30a10 APN 1 185455419 missense probably damaging 1.00
IGL01779:Slc30a10 APN 1 185464179 missense possibly damaging 0.94
IGL01906:Slc30a10 APN 1 185456396 nonsense probably null
IGL02024:Slc30a10 APN 1 185455241 missense possibly damaging 0.94
R0111:Slc30a10 UTSW 1 185455547 missense probably benign
R0133:Slc30a10 UTSW 1 185455173 missense probably damaging 1.00
R1886:Slc30a10 UTSW 1 185462864 missense probably damaging 1.00
R3915:Slc30a10 UTSW 1 185455136 nonsense probably null
R5597:Slc30a10 UTSW 1 185462700 missense probably damaging 1.00
R6175:Slc30a10 UTSW 1 185455311 missense probably damaging 1.00
R8108:Slc30a10 UTSW 1 185464154 missense possibly damaging 0.90
R8345:Slc30a10 UTSW 1 185455467 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CGAGAGATCTTCCACCATGC -3'
(R):5'- ATAAGCAGAGCTGGTGACACC -3'

Sequencing Primer
(F):5'- TGCTGGAATCCACAACGTG -3'
(R):5'- CACCAAAGTGTCTGTTCAGAC -3'
Posted On2018-07-24