Mutagenetix > Incidental Mutations

Incidental Mutation 'R6669:Slc30a10'

List [record 1 of 34] next >> last >|

528045

Institutional Source

Beutler Lab

Gene Symbol

Slc30a10

Ensembl Gene

ENSMUSG00000026614

Gene Name

solute carrier family 30, member 10

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R6669 (G1)

Quality Score

207.009

Status

Validated

Chromosome

Chromosomal Location

185454848-185468762 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 185464428 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 429 (R429Q)

Ref Sequence

ENSEMBL: ENSMUSP00000053181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061093]

Predicted Effect

probably benign
Transcript: ENSMUST00000061093
AA Change: R429Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000053181
Gene: ENSMUSG00000026614
AA Change: R429Q

Domain	Start	End	E-Value	Type
Pfam:Cation_efflux	11	299	2e-44	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.5%

Validation Efficiency

97% (33/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly expressed in the liver and is inducible by manganese. Its protein product appears to be critical in maintaining manganese levels, and has higher specificity for manganese than zinc. Loss of function mutations appear to result in a pleomorphic phenotype, including dystonia and adult-onset parkinsonism. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit post-weaning growth defects, increased manganese levels in the brain, blood, liver and thyroid gland, severe hypothyroidism and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,840,373	I1952V	probably benign	Het
Atg2b	T	C	12: 105,671,529	E142G	possibly damaging	Het
Bbc3	G	T	7: 16,313,716	A122S	possibly damaging	Het
Cenpu	T	C	8: 46,576,284	S191P	probably damaging	Het
Clic3	G	T	2: 25,457,767	R48L	possibly damaging	Het
Cmya5	T	C	13: 93,093,259	K1774E	probably benign	Het
Cnst	T	A	1: 179,605,073		probably null	Het
Cyfip1	T	A	7: 55,900,061	S657T	probably damaging	Het
Dock10	T	C	1: 80,592,855	Y322C	probably damaging	Het
Epn2	C	T	11: 61,519,558	V550I	probably benign	Het
Evc2	C	T	5: 37,378,378	P466S	possibly damaging	Het
Fancd2	C	T	6: 113,593,327	T1413I	probably benign	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Herc4	T	A	10: 63,286,068	W400R	probably benign	Het
Kcna7	T	C	7: 45,409,564	V425A	probably damaging	Het
Klhl3	A	T	13: 58,011,152	D564E	probably benign	Het
Man2b2	T	C	5: 36,810,358	I889V	probably benign	Het
Mcm3ap	A	G	10: 76,507,337	I1688V	probably damaging	Het
Mocos	T	A	18: 24,666,410	F234I	probably damaging	Het
Muc20	T	C	16: 32,793,937	T357A	possibly damaging	Het
Ncoa6	T	G	2: 155,399,693		probably null	Het
Nlk	C	A	11: 78,587,066	G284*	probably null	Het
Nrxn1	T	A	17: 90,059,563	T12S	probably damaging	Het
Nrxn2	A	G	19: 6,481,191	Y627C	probably damaging	Het
Ntn1	T	C	11: 68,385,750	N124S	probably benign	Het
Pdzd7	T	A	19: 45,036,751	Q435L	possibly damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,925		probably benign	Het
Tox4	T	C	14: 52,286,756	Y116H	probably damaging	Het
Trpv5	G	A	6: 41,658,042	A451V	probably damaging	Het
Ube3a	T	C	7: 59,276,857	V482A	probably benign	Het
Vcan	A	T	13: 89,704,731	D703E	probably benign	Het
Xirp2	C	A	2: 67,513,355	A1980E	possibly damaging	Het
Xrcc1	T	C	7: 24,547,337	V10A	probably damaging	Het

Other mutations in Slc30a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01485:Slc30a10	APN	1	185455419	missense	probably damaging	1.00
IGL01779:Slc30a10	APN	1	185464179	missense	possibly damaging	0.94
IGL01906:Slc30a10	APN	1	185456396	nonsense	probably null
IGL02024:Slc30a10	APN	1	185455241	missense	possibly damaging	0.94
R0111:Slc30a10	UTSW	1	185455547	missense	probably benign
R0133:Slc30a10	UTSW	1	185455173	missense	probably damaging	1.00
R1886:Slc30a10	UTSW	1	185462864	missense	probably damaging	1.00
R3915:Slc30a10	UTSW	1	185455136	nonsense	probably null
R5597:Slc30a10	UTSW	1	185462700	missense	probably damaging	1.00
R6175:Slc30a10	UTSW	1	185455311	missense	probably damaging	1.00
R8108:Slc30a10	UTSW	1	185464154	missense	possibly damaging	0.90
R8345:Slc30a10	UTSW	1	185455467	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- CGAGAGATCTTCCACCATGC -3'
(R):5'- ATAAGCAGAGCTGGTGACACC -3'

Sequencing Primer
(F):5'- TGCTGGAATCCACAACGTG -3'
(R):5'- CACCAAAGTGTCTGTTCAGAC -3'

Posted On

2018-07-24