Mutagenetix > Incidental Mutation

Incidental Mutation 'R6669:Clic3'

528046

Institutional Source

Beutler Lab

Gene Symbol

Clic3

Ensembl Gene

ENSMUSG00000015093

Gene Name

chloride intracellular channel 3

Synonyms

2300003G24Rik

MMRRC Submission

044789-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R6669 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25346855-25348789 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 25347779 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 48 (R48L)

Ref Sequence

ENSEMBL: ENSMUSP00000109904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102918] [ENSMUST00000114261] [ENSMUST00000114265] [ENSMUST00000151239]

AlphaFold

Q9D7P7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102918
AA Change: R46L

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099982
Gene: ENSMUSG00000015093
AA Change: R46L

Domain	Start	End	E-Value	Type
Pfam:GST_N_3	17	89	9.8e-11	PFAM
Pfam:GST_N_2	20	84	1.6e-8	PFAM
Pfam:GST_C_2	77	207	6.3e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114261

SMART Domains

Protein: ENSMUSP00000109899
Gene: ENSMUSG00000047617

Domain	Start	End	E-Value	Type
Pfam:PAXX	10	205	5.7e-93	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114265
AA Change: R48L

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109904
Gene: ENSMUSG00000015093
AA Change: R48L

Domain	Start	End	E-Value	Type
Pfam:GST_N_3	19	91	2e-11	PFAM
Pfam:GST_N_2	22	86	3.6e-9	PFAM
Pfam:GST_C_2	80	209	1.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123986

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124172

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125710

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128560

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143862

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141613

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130130

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132561

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133919

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135915

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132596

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132311

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142006

Predicted Effect

probably benign
Transcript: ENSMUST00000151239

SMART Domains

Protein: ENSMUSP00000120533
Gene: ENSMUSG00000047617

Domain	Start	End	E-Value	Type
Pfam:DUF4610	8	156	2.2e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140022

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138079

Meta Mutation Damage Score

0.1531

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.5%

Validation Efficiency

97% (33/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 3 is a member of the p64 family and is predominantly localized in the nucleus and stimulates chloride ion channel activity. In addition, this protein may participate in cellular growth control, based on its association with ERK7, a member of the MAP kinase family. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,716,469 (GRCm39)	I1952V	probably benign	Het
Atg2b	T	C	12: 105,637,788 (GRCm39)	E142G	possibly damaging	Het
Bbc3	G	T	7: 16,047,641 (GRCm39)	A122S	possibly damaging	Het
Cenpu	T	C	8: 47,029,319 (GRCm39)	S191P	probably damaging	Het
Cmya5	T	C	13: 93,229,767 (GRCm39)	K1774E	probably benign	Het
Cnst	T	A	1: 179,432,638 (GRCm39)		probably null	Het
Cyfip1	T	A	7: 55,549,809 (GRCm39)	S657T	probably damaging	Het
Dock10	T	C	1: 80,570,572 (GRCm39)	Y322C	probably damaging	Het
Epn2	C	T	11: 61,410,384 (GRCm39)	V550I	probably benign	Het
Evc2	C	T	5: 37,535,722 (GRCm39)	P466S	possibly damaging	Het
Fancd2	C	T	6: 113,570,288 (GRCm39)	T1413I	probably benign	Het
Gpat2	G	C	2: 127,273,838 (GRCm39)	G294R	possibly damaging	Het
Herc4	T	A	10: 63,121,847 (GRCm39)	W400R	probably benign	Het
Kcna7	T	C	7: 45,058,988 (GRCm39)	V425A	probably damaging	Het
Klhl3	A	T	13: 58,158,966 (GRCm39)	D564E	probably benign	Het
Man2b2	T	C	5: 36,967,702 (GRCm39)	I889V	probably benign	Het
Mcm3ap	A	G	10: 76,343,171 (GRCm39)	I1688V	probably damaging	Het
Mocos	T	A	18: 24,799,467 (GRCm39)	F234I	probably damaging	Het
Muc20	T	C	16: 32,614,307 (GRCm39)	T357A	possibly damaging	Het
Ncoa6	T	G	2: 155,241,613 (GRCm39)		probably null	Het
Nlk	C	A	11: 78,477,892 (GRCm39)	G284*	probably null	Het
Nrxn1	T	A	17: 90,366,991 (GRCm39)	T12S	probably damaging	Het
Nrxn2	A	G	19: 6,531,221 (GRCm39)	Y627C	probably damaging	Het
Ntn1	T	C	11: 68,276,576 (GRCm39)	N124S	probably benign	Het
Pdzd7	T	A	19: 45,025,190 (GRCm39)	Q435L	possibly damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,229,132 (GRCm39)		probably benign	Het
Slc30a10	G	A	1: 185,196,625 (GRCm39)	R429Q	probably benign	Het
Tox4	T	C	14: 52,524,213 (GRCm39)	Y116H	probably damaging	Het
Trpv5	G	A	6: 41,634,976 (GRCm39)	A451V	probably damaging	Het
Ube3a	T	C	7: 58,926,605 (GRCm39)	V482A	probably benign	Het
Vcan	A	T	13: 89,852,850 (GRCm39)	D703E	probably benign	Het
Xirp2	C	A	2: 67,343,699 (GRCm39)	A1980E	possibly damaging	Het
Xrcc1	T	C	7: 24,246,762 (GRCm39)	V10A	probably damaging	Het

Other mutations in Clic3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
knife	UTSW	2	25,347,779 (GRCm39)	missense	possibly damaging	0.94
R0491:Clic3	UTSW	2	25,347,797 (GRCm39)	unclassified	probably benign
R0533:Clic3	UTSW	2	25,348,150 (GRCm39)	missense	probably damaging	1.00
R4798:Clic3	UTSW	2	25,348,194 (GRCm39)	missense	probably damaging	1.00
R4940:Clic3	UTSW	2	25,347,929 (GRCm39)	missense	probably benign	0.00
R5579:Clic3	UTSW	2	25,348,319 (GRCm39)	missense	probably damaging	0.99
R5713:Clic3	UTSW	2	25,348,179 (GRCm39)	missense	probably damaging	1.00
R7169:Clic3	UTSW	2	25,348,731 (GRCm39)	missense	probably benign	0.02
R8033:Clic3	UTSW	2	25,348,617 (GRCm39)	missense	probably benign	0.00
R9131:Clic3	UTSW	2	25,348,325 (GRCm39)	missense	probably benign	0.00
R9457:Clic3	UTSW	2	25,347,730 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAGATGCCATGCTCAACCAGG -3'
(R):5'- CGATCTGCAGTGTGTCTGTC -3'

Sequencing Primer
(F):5'- TGCCTCCAGAGCCAATGG -3'
(R):5'- GTCTTGACATCCCCATCGTACAG -3'

Posted On

2018-07-24