Incidental Mutation 'R6669:Clic3'
List |< first << previous [record 5 of 34] next >> last >|
ID528046
Institutional Source Beutler Lab
Gene Symbol Clic3
Ensembl Gene ENSMUSG00000015093
Gene Namechloride intracellular channel 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6669 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25456838-25458776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25457767 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 48 (R48L)
Ref Sequence ENSEMBL: ENSMUSP00000109904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102918] [ENSMUST00000114261] [ENSMUST00000114265] [ENSMUST00000151239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102918
AA Change: R46L

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099982
Gene: ENSMUSG00000015093
AA Change: R46L

DomainStartEndE-ValueType
Pfam:GST_N_3 17 89 9.8e-11 PFAM
Pfam:GST_N_2 20 84 1.6e-8 PFAM
Pfam:GST_C_2 77 207 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114261
SMART Domains Protein: ENSMUSP00000109899
Gene: ENSMUSG00000047617

DomainStartEndE-ValueType
Pfam:PAXX 10 205 5.7e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114265
AA Change: R48L

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109904
Gene: ENSMUSG00000015093
AA Change: R48L

DomainStartEndE-ValueType
Pfam:GST_N_3 19 91 2e-11 PFAM
Pfam:GST_N_2 22 86 3.6e-9 PFAM
Pfam:GST_C_2 80 209 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142006
Predicted Effect probably benign
Transcript: ENSMUST00000151239
SMART Domains Protein: ENSMUSP00000120533
Gene: ENSMUSG00000047617

DomainStartEndE-ValueType
Pfam:DUF4610 8 156 2.2e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138079
Meta Mutation Damage Score 0.1531 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 3 is a member of the p64 family and is predominantly localized in the nucleus and stimulates chloride ion channel activity. In addition, this protein may participate in cellular growth control, based on its association with ERK7, a member of the MAP kinase family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Clic3
AlleleSourceChrCoordTypePredicted EffectPPH Score
knife UTSW 2 25457767 missense possibly damaging 0.94
R0491:Clic3 UTSW 2 25457785 unclassified probably benign
R0533:Clic3 UTSW 2 25458138 missense probably damaging 1.00
R4798:Clic3 UTSW 2 25458182 missense probably damaging 1.00
R4940:Clic3 UTSW 2 25457917 missense probably benign 0.00
R5579:Clic3 UTSW 2 25458307 missense probably damaging 0.99
R5713:Clic3 UTSW 2 25458167 missense probably damaging 1.00
R7169:Clic3 UTSW 2 25458719 missense probably benign 0.02
R8033:Clic3 UTSW 2 25458605 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGATGCCATGCTCAACCAGG -3'
(R):5'- CGATCTGCAGTGTGTCTGTC -3'

Sequencing Primer
(F):5'- TGCCTCCAGAGCCAATGG -3'
(R):5'- GTCTTGACATCCCCATCGTACAG -3'
Posted On2018-07-24