Incidental Mutation 'R6669:Gpat2'
List |< first << previous [record 13 of 34] next >> last >|
ID528048
Institutional Source Beutler Lab
Gene Symbol Gpat2
Ensembl Gene ENSMUSG00000046338
Gene Nameglycerol-3-phosphate acyltransferase 2, mitochondrial
SynonymsGpat2, A530057A03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6669 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127425199-127436092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 127431918 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 294 (G294R)
Ref Sequence ENSEMBL: ENSMUSP00000049619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028848] [ENSMUST00000062211]
Predicted Effect probably benign
Transcript: ENSMUST00000028848
SMART Domains Protein: ENSMUSP00000028848
Gene: ENSMUSG00000027371

DomainStartEndE-ValueType
low complexity region 47 53 N/A INTRINSIC
Pfam:FAA_hydrolase 107 313 3.1e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000062211
AA Change: G294R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049619
Gene: ENSMUSG00000046338
AA Change: G294R

DomainStartEndE-ValueType
PlsC 199 333 1.45e-11 SMART
Blast:PlsC 347 387 7e-13 BLAST
low complexity region 431 468 N/A INTRINSIC
low complexity region 515 528 N/A INTRINSIC
low complexity region 593 613 N/A INTRINSIC
low complexity region 664 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146757
Meta Mutation Damage Score 0.3984 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Gpat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Gpat2 APN 2 127432396 missense probably benign 0.01
IGL00479:Gpat2 APN 2 127434461 missense probably damaging 0.99
IGL01393:Gpat2 APN 2 127432651 missense probably damaging 1.00
IGL01759:Gpat2 APN 2 127430896 missense possibly damaging 0.94
IGL01764:Gpat2 APN 2 127427536 missense probably benign 0.18
IGL02631:Gpat2 APN 2 127434232 splice site probably benign
IGL02657:Gpat2 APN 2 127427331 missense probably benign 0.04
IGL02813:Gpat2 APN 2 127434455 missense possibly damaging 0.90
IGL02873:Gpat2 APN 2 127431755 missense probably benign 0.00
IGL02993:Gpat2 APN 2 127427566 missense probably damaging 1.00
R6669_gpat2_048 UTSW 2 127431918 missense possibly damaging 0.90
PIT4494001:Gpat2 UTSW 2 127433880 missense probably benign 0.00
R0078:Gpat2 UTSW 2 127428249 missense probably damaging 1.00
R0230:Gpat2 UTSW 2 127435845 missense possibly damaging 0.95
R1619:Gpat2 UTSW 2 127428717 missense probably benign 0.00
R1851:Gpat2 UTSW 2 127434819 missense possibly damaging 0.77
R1939:Gpat2 UTSW 2 127435959 makesense probably null
R2143:Gpat2 UTSW 2 127433762 missense probably damaging 1.00
R2165:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R2518:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3410:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3411:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3898:Gpat2 UTSW 2 127435098 missense probably damaging 1.00
R4080:Gpat2 UTSW 2 127433622 missense probably damaging 0.99
R4725:Gpat2 UTSW 2 127431982 missense possibly damaging 0.83
R4841:Gpat2 UTSW 2 127433967 missense probably benign 0.10
R5354:Gpat2 UTSW 2 127428723 missense probably damaging 1.00
R5941:Gpat2 UTSW 2 127428275 missense possibly damaging 0.53
R6362:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6374:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6375:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6377:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6380:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6381:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6382:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6383:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6384:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6393:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6565:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6594:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6595:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6649:Gpat2 UTSW 2 127432435 missense possibly damaging 0.81
R6665:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6666:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6667:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6668:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R7031:Gpat2 UTSW 2 127435475 missense probably damaging 0.99
R7096:Gpat2 UTSW 2 127428289 missense probably benign 0.02
R7307:Gpat2 UTSW 2 127434890 missense probably damaging 1.00
R7313:Gpat2 UTSW 2 127428295 missense probably damaging 0.99
R7365:Gpat2 UTSW 2 127426981 splice site probably null
R8111:Gpat2 UTSW 2 127433857 missense probably damaging 1.00
R8113:Gpat2 UTSW 2 127431347 missense possibly damaging 0.52
Z1176:Gpat2 UTSW 2 127430882 missense probably benign
Z1176:Gpat2 UTSW 2 127433808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCAGAGGGCATCCTTGC -3'
(R):5'- AACATTGTGCCACCCAGAACTG -3'

Sequencing Primer
(F):5'- CATCCTTGCAAGGGCTGTG -3'
(R):5'- GGTTGATAATCTACTCGGATCCCAG -3'
Posted On2018-07-24