Incidental Mutation 'R6669:Bbc3'
ID528054
Institutional Source Beutler Lab
Gene Symbol Bbc3
Ensembl Gene ENSMUSG00000002083
Gene NameBCL2 binding component 3
SynonymsPUMA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6669 (G1)
Quality Score116.008
Status Validated
Chromosome7
Chromosomal Location16308393-16318205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16313716 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 122 (A122S)
Ref Sequence ENSEMBL: ENSMUSP00000119225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002152] [ENSMUST00000136781] [ENSMUST00000209688]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002152
AA Change: A122S

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002152
Gene: ENSMUSG00000002083
AA Change: A122S

DomainStartEndE-ValueType
Pfam:PUMA 2 193 8.5e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136781
AA Change: A122S

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119225
Gene: ENSMUSG00000002083
AA Change: A122S

DomainStartEndE-ValueType
low complexity region 42 71 N/A INTRINSIC
low complexity region 73 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147267
Predicted Effect probably benign
Transcript: ENSMUST00000209688
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in apoptosis but otherwise are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Bbc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
Dunnaway UTSW 7 16313808 nonsense probably null
R2130:Bbc3 UTSW 7 16312343 missense possibly damaging 0.51
R6935:Bbc3 UTSW 7 16312199 missense possibly damaging 0.92
R7159:Bbc3 UTSW 7 16313808 nonsense probably null
R7393:Bbc3 UTSW 7 16313789 missense probably benign 0.08
R7464:Bbc3 UTSW 7 16317157 missense unknown
R7575:Bbc3 UTSW 7 16312367 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGAAAGCACAGTGTAGCTCC -3'
(R):5'- GCATCCAGCAGATCCATTCC -3'

Sequencing Primer
(F):5'- ACAGTGTAGCTCCTGGGC -3'
(R):5'- ATCTGCTTGTCCCTGGCG -3'
Posted On2018-07-24