Incidental Mutation 'R6669:Xrcc1'
List |< first << previous [record 34 of 34]
ID528055
Institutional Source Beutler Lab
Gene Symbol Xrcc1
Ensembl Gene ENSMUSG00000051768
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 1
SynonymsXrcc-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6669 (G1)
Quality Score135.008
Status Validated
Chromosome7
Chromosomal Location24546289-24573440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24547337 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 10 (V10A)
Ref Sequence ENSEMBL: ENSMUSP00000146105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011776] [ENSMUST00000063249] [ENSMUST00000205573]
Predicted Effect probably benign
Transcript: ENSMUST00000011776
SMART Domains Protein: ENSMUSP00000011776
Gene: ENSMUSG00000011632

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LU 27 123 9.63e-2 SMART
Pfam:UPAR_LY6 126 191 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063249
AA Change: V10A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070995
Gene: ENSMUSG00000051768
AA Change: V10A

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 151 6.9e-66 PFAM
low complexity region 212 238 N/A INTRINSIC
low complexity region 278 294 N/A INTRINSIC
BRCT 317 393 8e-19 SMART
low complexity region 407 424 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
BRCT 538 617 5.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205561
Predicted Effect probably damaging
Transcript: ENSMUST00000205573
AA Change: V10A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206889
Meta Mutation Damage Score 0.4291 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants accumulate unrepaired DNA strand breaks in the egg cylinder, show increased cell death in epiblast, developmental arrest at embryonic day 6.5, morphological anomalies in visceral embryonic endoderm by day 7.5 and die by day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Other mutations in Xrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Xrcc1 APN 7 24547884 critical splice donor site probably null
IGL01830:Xrcc1 APN 7 24573342 utr 3 prime probably benign
IGL02349:Xrcc1 APN 7 24567042 nonsense probably null
IGL02433:Xrcc1 APN 7 24565554 missense possibly damaging 0.96
IGL03131:Xrcc1 APN 7 24573294 nonsense probably null
Bilberry UTSW 7 24570218 missense probably damaging 1.00
R0090:Xrcc1 UTSW 7 24570217 missense probably damaging 0.99
R0517:Xrcc1 UTSW 7 24570319 splice site probably benign
R0612:Xrcc1 UTSW 7 24570319 splice site probably benign
R1234:Xrcc1 UTSW 7 24567845 missense possibly damaging 0.71
R1577:Xrcc1 UTSW 7 24565627 nonsense probably null
R1796:Xrcc1 UTSW 7 24547827 missense probably damaging 1.00
R1863:Xrcc1 UTSW 7 24570575 missense possibly damaging 0.65
R3788:Xrcc1 UTSW 7 24566908 missense probably benign 0.08
R3794:Xrcc1 UTSW 7 24570560 missense probably benign 0.05
R4806:Xrcc1 UTSW 7 24570480 missense probably benign 0.14
R5206:Xrcc1 UTSW 7 24567563 missense probably damaging 1.00
R5414:Xrcc1 UTSW 7 24570218 missense probably damaging 1.00
R5532:Xrcc1 UTSW 7 24567928 critical splice donor site probably null
R5624:Xrcc1 UTSW 7 24559845 missense possibly damaging 0.57
R5990:Xrcc1 UTSW 7 24567868 missense probably damaging 1.00
R6603:Xrcc1 UTSW 7 24571034 nonsense probably null
R6716:Xrcc1 UTSW 7 24567146 critical splice donor site probably null
R6881:Xrcc1 UTSW 7 24547351 nonsense probably null
R7227:Xrcc1 UTSW 7 24547332 missense probably damaging 1.00
R8204:Xrcc1 UTSW 7 24572284 missense possibly damaging 0.88
R8284:Xrcc1 UTSW 7 24572278 missense probably damaging 1.00
R8285:Xrcc1 UTSW 7 24572278 missense probably damaging 1.00
R8287:Xrcc1 UTSW 7 24572278 missense probably damaging 1.00
X0019:Xrcc1 UTSW 7 24573128 missense probably damaging 1.00
X0024:Xrcc1 UTSW 7 24573079 missense probably damaging 1.00
Z1176:Xrcc1 UTSW 7 24547839 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ATGCCTGTTGCTAAGGGAAC -3'
(R):5'- AGTTAGAACTTCCCAGGCCC -3'

Sequencing Primer
(F):5'- AGCATGCGCAGTGTTGAC -3'
(R):5'- AAAGTCCTCAGCATCCCT -3'
Posted On2018-07-24