Incidental Mutation 'R6669:Kcna7'
ID528056
Institutional Source Beutler Lab
Gene Symbol Kcna7
Ensembl Gene ENSMUSG00000038201
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 7
SynonymsKv1.7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6669 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45405653-45409763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45409564 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 425 (V425A)
Ref Sequence ENSEMBL: ENSMUSP00000103403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058879] [ENSMUST00000107774] [ENSMUST00000210347]
Predicted Effect probably benign
Transcript: ENSMUST00000058879
SMART Domains Protein: ENSMUSP00000057916
Gene: ENSMUSG00000074121

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 50 74 N/A INTRINSIC
NGF 88 201 8.06e-83 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107774
AA Change: V425A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103403
Gene: ENSMUSG00000038201
AA Change: V425A

DomainStartEndE-ValueType
BTB 45 145 1.77e-7 SMART
Pfam:Ion_trans 174 438 1.7e-52 PFAM
Pfam:Ion_trans_2 346 432 1.7e-13 PFAM
low complexity region 471 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210347
Meta Mutation Damage Score 0.7380 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. The gene is expressed preferentially in skeletal muscle, heart and kidney. It is a candidate gene for inherited cardiac disorders. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Kcna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Kcna7 APN 7 45406511 missense probably damaging 1.00
IGL02477:Kcna7 APN 7 45409623 missense probably benign 0.01
R0373:Kcna7 UTSW 7 45409444 missense probably damaging 1.00
R0624:Kcna7 UTSW 7 45409690 missense probably null 1.00
R0850:Kcna7 UTSW 7 45409431 missense probably damaging 0.99
R1721:Kcna7 UTSW 7 45406921 missense possibly damaging 0.95
R1727:Kcna7 UTSW 7 45409506 missense possibly damaging 0.94
R3040:Kcna7 UTSW 7 45406788 frame shift probably null
R3755:Kcna7 UTSW 7 45408945 missense probably benign 0.00
R5024:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5054:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5055:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5056:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5549:Kcna7 UTSW 7 45406639 missense probably damaging 0.98
R7284:Kcna7 UTSW 7 45409228 missense probably damaging 1.00
R7309:Kcna7 UTSW 7 45409255 missense probably damaging 1.00
R8028:Kcna7 UTSW 7 45409523 nonsense probably null
R8326:Kcna7 UTSW 7 45409341 missense probably damaging 1.00
Z1088:Kcna7 UTSW 7 45406959 missense probably benign 0.21
Z1088:Kcna7 UTSW 7 45409105 missense probably damaging 1.00
Z1177:Kcna7 UTSW 7 45409183 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCAGCGCAGTCTACTTTG -3'
(R):5'- AGTTGACCCTCACACCTCAG -3'

Sequencing Primer
(F):5'- CAGCGCAGTCTACTTTGCTGAAG -3'
(R):5'- ACCATGTGTTTCCCTGCAGG -3'
Posted On2018-07-24