Incidental Mutation 'R6669:Cenpu'
ID528060
Institutional Source Beutler Lab
Gene Symbol Cenpu
Ensembl Gene ENSMUSG00000031629
Gene Namecentromere protein U
Synonyms1700029A22Rik, Mlf1ip
MMRRC Submission
Accession Numbers

Genbank: NM_027973; MGI: 1919126

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6669 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location46552028-46580007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46576284 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 191 (S191P)
Ref Sequence ENSEMBL: ENSMUSP00000091239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034045] [ENSMUST00000040468] [ENSMUST00000093518] [ENSMUST00000135432] [ENSMUST00000136335] [ENSMUST00000209787] [ENSMUST00000211400]
Predicted Effect probably damaging
Transcript: ENSMUST00000034045
AA Change: S341P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034045
Gene: ENSMUSG00000031629
AA Change: S341P

DomainStartEndE-ValueType
low complexity region 58 66 N/A INTRINSIC
Pfam:CENP-U 138 312 6.5e-74 PFAM
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040468
SMART Domains Protein: ENSMUSP00000036119
Gene: ENSMUSG00000038225

DomainStartEndE-ValueType
Pfam:Herpes_UL52 384 448 1.3e-19 PFAM
low complexity region 465 478 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093518
AA Change: S191P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091239
Gene: ENSMUSG00000031629
AA Change: S191P

DomainStartEndE-ValueType
Pfam:CENP-U 39 162 4.6e-61 PFAM
low complexity region 190 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122838
Predicted Effect probably benign
Transcript: ENSMUST00000135432
Predicted Effect probably benign
Transcript: ENSMUST00000136335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136724
Predicted Effect probably benign
Transcript: ENSMUST00000209787
Predicted Effect probably benign
Transcript: ENSMUST00000211400
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). MLF1IP, or CENPU, is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E7.5 and E9.5, small embryo size and thickened visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Cenpu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Cenpu APN 8 46578319 missense probably damaging 1.00
IGL02968:Cenpu APN 8 46556195 critical splice donor site probably null
3-1:Cenpu UTSW 8 46573488 unclassified probably benign
PIT4403001:Cenpu UTSW 8 46562529 missense possibly damaging 0.81
R0278:Cenpu UTSW 8 46578309 missense probably damaging 0.99
R1882:Cenpu UTSW 8 46556190 missense probably damaging 1.00
R1957:Cenpu UTSW 8 46572837 unclassified probably benign
R2894:Cenpu UTSW 8 46576349 missense probably damaging 1.00
R4528:Cenpu UTSW 8 46562422 nonsense probably null
R5279:Cenpu UTSW 8 46578910 splice site probably null
R5384:Cenpu UTSW 8 46562499 missense probably benign
R6196:Cenpu UTSW 8 46562580 missense probably benign 0.28
R6562:Cenpu UTSW 8 46572823 missense possibly damaging 0.93
R7723:Cenpu UTSW 8 46576314 missense probably damaging 1.00
R7792:Cenpu UTSW 8 46562467 missense possibly damaging 0.92
R7895:Cenpu UTSW 8 46562464 missense probably benign
R8395:Cenpu UTSW 8 46554049 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATGTTCATGCTTGTACACTCTATG -3'
(R):5'- TTTCTGCAAACTGCTGCCAC -3'

Sequencing Primer
(F):5'- AAATGTTTTGTTATTTTTGGTTTGCG -3'
(R):5'- CTCTACAAGCAAATGCCTGGATC -3'
Posted On2018-07-24