Incidental Mutation 'R6669:Epn2'
ID528064
Institutional Source Beutler Lab
Gene Symbol Epn2
Ensembl Gene ENSMUSG00000001036
Gene Nameepsin 2
SynonymsIbp2, 9530051D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6669 (G1)
Quality Score192.009
Status Validated
Chromosome11
Chromosomal Location61517249-61579687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61519558 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 550 (V550I)
Ref Sequence ENSEMBL: ENSMUSP00000136553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001063] [ENSMUST00000108711] [ENSMUST00000108712] [ENSMUST00000108713] [ENSMUST00000178202] [ENSMUST00000179936]
Predicted Effect probably benign
Transcript: ENSMUST00000001063
AA Change: V550I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000001063
Gene: ENSMUSG00000001036
AA Change: V550I

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 3.37e-1 SMART
UIM 255 274 2.48e1 SMART
low complexity region 449 461 N/A INTRINSIC
low complexity region 493 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108711
AA Change: V532I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104351
Gene: ENSMUSG00000001036
AA Change: V532I

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 6.29e-1 SMART
UIM 243 262 2.48e1 SMART
low complexity region 431 443 N/A INTRINSIC
low complexity region 475 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108712
AA Change: V589I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104352
Gene: ENSMUSG00000001036
AA Change: V589I

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 275 294 6.29e-1 SMART
UIM 300 319 2.48e1 SMART
low complexity region 488 500 N/A INTRINSIC
low complexity region 532 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108713
AA Change: V538I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104353
Gene: ENSMUSG00000001036
AA Change: V538I

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 6.29e-1 SMART
UIM 243 262 2.48e1 SMART
low complexity region 437 449 N/A INTRINSIC
low complexity region 481 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148956
SMART Domains Protein: ENSMUSP00000122514
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
SCOP:d1eyha_ 2 35 1e-9 SMART
PDB:1EDU|A 2 37 5e-8 PDB
UIM 152 171 6.29e-1 SMART
UIM 177 196 2.48e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178202
AA Change: V550I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000136553
Gene: ENSMUSG00000001036
AA Change: V550I

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 3.37e-1 SMART
UIM 255 274 2.48e1 SMART
low complexity region 449 461 N/A INTRINSIC
low complexity region 493 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179936
AA Change: V595I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136950
Gene: ENSMUSG00000001036
AA Change: V595I

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 275 294 6.29e-1 SMART
UIM 300 319 2.48e1 SMART
low complexity region 494 506 N/A INTRINSIC
low complexity region 538 562 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with clathrin and adaptor-related protein complex 2, alpha 1 subunit. The protein is found in a brain-derived clathrin-coated vesicle fraction and localizes to the peri-Golgi region and the cell periphery. The protein is thought to be involved in clathrin-mediated endocytosis. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. Mice homozygous null for both Epn1 and Epn2 display defects in angiogenic vascular remodeling, impaired somitogenesis and extensive cell death in the nervous tissue, resulting in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Epn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Epn2 APN 11 61523086 missense probably benign 0.00
IGL01582:Epn2 APN 11 61521869 missense probably benign 0.00
IGL02375:Epn2 APN 11 61519671 missense probably damaging 1.00
IGL03213:Epn2 APN 11 61519684 missense probably damaging 0.99
Ipanema UTSW 11 61519558 missense probably benign 0.00
R0400:Epn2 UTSW 11 61532696 splice site probably null
R0458:Epn2 UTSW 11 61546455 missense possibly damaging 0.89
R0471:Epn2 UTSW 11 61535308 missense probably damaging 1.00
R0833:Epn2 UTSW 11 61519491 missense probably benign 0.01
R0836:Epn2 UTSW 11 61519491 missense probably benign 0.01
R1418:Epn2 UTSW 11 61523086 missense probably benign 0.00
R1699:Epn2 UTSW 11 61523188 nonsense probably null
R1743:Epn2 UTSW 11 61546411 missense possibly damaging 0.92
R4039:Epn2 UTSW 11 61546522 missense probably damaging 1.00
R4696:Epn2 UTSW 11 61535303 missense probably damaging 1.00
R4752:Epn2 UTSW 11 61546371 missense probably damaging 1.00
R4913:Epn2 UTSW 11 61534576 critical splice donor site probably null
R6053:Epn2 UTSW 11 61546497 missense probably damaging 1.00
R6302:Epn2 UTSW 11 61546486 missense probably damaging 1.00
R6455:Epn2 UTSW 11 61533641 missense probably damaging 1.00
R7032:Epn2 UTSW 11 61546702 missense probably damaging 1.00
R7439:Epn2 UTSW 11 61546848 start gained probably benign
R8008:Epn2 UTSW 11 61546666 missense probably damaging 1.00
R8128:Epn2 UTSW 11 61522495 splice site probably null
Z1177:Epn2 UTSW 11 61546424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGAGTGAGTCCCCACTTG -3'
(R):5'- CAGTGGCTCATCCTGTGTTC -3'

Sequencing Primer
(F):5'- GAGTGAGTCCCCACTTGACATC -3'
(R):5'- GTTCTTGCTCTTTTACCAGGTGCTG -3'
Posted On2018-07-24