Mutagenetix > Incidental Mutations

Incidental Mutation 'R6669:Klhl3'

528068

Institutional Source

Beutler Lab

Gene Symbol

Klhl3

Ensembl Gene

ENSMUSG00000014164

Gene Name

kelch-like 3

Synonyms

EG627648, 7530408C15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6669 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58000228-58113592 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58011152 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 564 (D564E)

Ref Sequence

ENSEMBL: ENSMUSP00000089173 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091583] [ENSMUST00000160860]

Predicted Effect

probably benign
Transcript: ENSMUST00000091583
AA Change: D564E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000089173
Gene: ENSMUSG00000014164
AA Change: D564E

Domain	Start	End	E-Value	Type
BTB	103	200	9.36e-30	SMART
BACK	205	307	7.49e-42	SMART
Kelch	355	400	3.31e-9	SMART
Kelch	401	447	3.82e-14	SMART
Kelch	448	494	1.49e-16	SMART
Kelch	495	543	8.58e-17	SMART
Kelch	544	590	4.93e-17	SMART
Kelch	591	638	4.16e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160860
AA Change: D511E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000123701
Gene: ENSMUSG00000014164
AA Change: D511E

Domain	Start	End	E-Value	Type
BTB	64	161	9.36e-30	SMART
BACK	166	268	7.49e-42	SMART
Kelch	316	361	3.31e-9	SMART
Kelch	362	408	3.82e-14	SMART
Kelch	409	455	1.49e-16	SMART
Kelch	456	504	8.58e-17	SMART
Kelch	505	551	4.93e-17	SMART
Kelch	552	599	4.16e-15	SMART

Meta Mutation Damage Score

0.1442

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.5%

Validation Efficiency

97% (33/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and encodes a full-length protein which has an N-terminal BTB domain followed by a BACK domain and six kelch-like repeats in the C-terminus. These kelch-like repeats promote substrate ubiquitination of bound proteins via interaction of the BTB domain with the CUL3 (cullin 3) component of a cullin-RING E3 ubiquitin ligase (CRL) complex. Muatations in this gene cause pseudohypoaldosteronism type IID (PHA2D); a rare Mendelian syndrome featuring hypertension, hyperkalaemia and metabolic acidosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a point mutation display salt-sensitive hypertension, hyperkalemia and metabolic acidosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,840,373	I1952V	probably benign	Het
Atg2b	T	C	12: 105,671,529	E142G	possibly damaging	Het
Bbc3	G	T	7: 16,313,716	A122S	possibly damaging	Het
Cenpu	T	C	8: 46,576,284	S191P	probably damaging	Het
Clic3	G	T	2: 25,457,767	R48L	possibly damaging	Het
Cmya5	T	C	13: 93,093,259	K1774E	probably benign	Het
Cnst	T	A	1: 179,605,073		probably null	Het
Cyfip1	T	A	7: 55,900,061	S657T	probably damaging	Het
Dock10	T	C	1: 80,592,855	Y322C	probably damaging	Het
Epn2	C	T	11: 61,519,558	V550I	probably benign	Het
Evc2	C	T	5: 37,378,378	P466S	possibly damaging	Het
Fancd2	C	T	6: 113,593,327	T1413I	probably benign	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Herc4	T	A	10: 63,286,068	W400R	probably benign	Het
Kcna7	T	C	7: 45,409,564	V425A	probably damaging	Het
Man2b2	T	C	5: 36,810,358	I889V	probably benign	Het
Mcm3ap	A	G	10: 76,507,337	I1688V	probably damaging	Het
Mocos	T	A	18: 24,666,410	F234I	probably damaging	Het
Muc20	T	C	16: 32,793,937	T357A	possibly damaging	Het
Ncoa6	T	G	2: 155,399,693		probably null	Het
Nlk	C	A	11: 78,587,066	G284*	probably null	Het
Nrxn1	T	A	17: 90,059,563	T12S	probably damaging	Het
Nrxn2	A	G	19: 6,481,191	Y627C	probably damaging	Het
Ntn1	T	C	11: 68,385,750	N124S	probably benign	Het
Pdzd7	T	A	19: 45,036,751	Q435L	possibly damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,925		probably benign	Het
Slc30a10	G	A	1: 185,464,428	R429Q	probably benign	Het
Tox4	T	C	14: 52,286,756	Y116H	probably damaging	Het
Trpv5	G	A	6: 41,658,042	A451V	probably damaging	Het
Ube3a	T	C	7: 59,276,857	V482A	probably benign	Het
Vcan	A	T	13: 89,704,731	D703E	probably benign	Het
Xirp2	C	A	2: 67,513,355	A1980E	possibly damaging	Het
Xrcc1	T	C	7: 24,547,337	V10A	probably damaging	Het

Other mutations in Klhl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01790:Klhl3	APN	13	58009422	critical splice acceptor site	probably null
IGL01984:Klhl3	APN	13	58011243	splice site	probably benign
IGL02022:Klhl3	APN	13	58051064	missense	possibly damaging	0.95
IGL02543:Klhl3	APN	13	58018871	missense	probably damaging	1.00
bearded_dragon	UTSW	13	58011152	missense	probably benign	0.00
R0975:Klhl3	UTSW	13	58013863	missense	possibly damaging	0.81
R1386:Klhl3	UTSW	13	58030433	missense	probably damaging	0.99
R1588:Klhl3	UTSW	13	58013898	missense	probably damaging	1.00
R1791:Klhl3	UTSW	13	58033230	missense	possibly damaging	0.87
R1894:Klhl3	UTSW	13	58009375	missense	probably damaging	1.00
R1953:Klhl3	UTSW	13	58011208	missense	probably damaging	1.00
R2116:Klhl3	UTSW	13	58018991	missense	probably damaging	0.99
R3114:Klhl3	UTSW	13	58051027	critical splice donor site	probably null
R4082:Klhl3	UTSW	13	58018797	missense	probably null	1.00
R4717:Klhl3	UTSW	13	58030516	missense	probably damaging	1.00
R4857:Klhl3	UTSW	13	58018806	missense	probably damaging	1.00
R4934:Klhl3	UTSW	13	58102417	nonsense	probably null
R5112:Klhl3	UTSW	13	58018889	missense	probably damaging	1.00
R5114:Klhl3	UTSW	13	58018967	missense	probably benign	0.24
R5547:Klhl3	UTSW	13	58102429	splice site	probably null
R5776:Klhl3	UTSW	13	58005184	missense	probably benign	0.00
R6236:Klhl3	UTSW	13	58085062	missense	probably damaging	1.00
R6268:Klhl3	UTSW	13	58013842	missense	probably damaging	1.00
R6457:Klhl3	UTSW	13	58100378	missense	probably benign	0.01
R6559:Klhl3	UTSW	13	58016476	missense	probably damaging	1.00
R6580:Klhl3	UTSW	13	58018887	missense	possibly damaging	0.75
R6601:Klhl3	UTSW	13	58095116	missense	probably damaging	0.96
R6904:Klhl3	UTSW	13	58030445	missense	probably damaging	1.00
R7652:Klhl3	UTSW	13	58113332	start gained	probably benign
R7979:Klhl3	UTSW	13	58063797	missense	probably benign	0.39
R8112:Klhl3	UTSW	13	58013863	missense	possibly damaging	0.81
R8114:Klhl3	UTSW	13	58013863	missense	possibly damaging	0.81
R8270:Klhl3	UTSW	13	58113154	missense
R8409:Klhl3	UTSW	13	58019428	missense	probably damaging	1.00
Z1177:Klhl3	UTSW	13	58009409	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CGCCACTCTTATGTTCAGGAC -3'
(R):5'- GAACCTCCTTATTTGCAGGCTG -3'

Sequencing Primer
(F):5'- CACTCTTATGTTCAGGACACAGGG -3'
(R):5'- TTTACAGATTAGGGCAATGAGGTCC -3'

Posted On

2018-07-24