Incidental Mutation 'R6669:Klhl3'
List |< first << previous [record 16 of 34] next >> last >|
ID528068
Institutional Source Beutler Lab
Gene Symbol Klhl3
Ensembl Gene ENSMUSG00000014164
Gene Namekelch-like 3
SynonymsEG627648, 7530408C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6669 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location58000228-58113592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58011152 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 564 (D564E)
Ref Sequence ENSEMBL: ENSMUSP00000089173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091583] [ENSMUST00000160860]
Predicted Effect probably benign
Transcript: ENSMUST00000091583
AA Change: D564E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000089173
Gene: ENSMUSG00000014164
AA Change: D564E

DomainStartEndE-ValueType
BTB 103 200 9.36e-30 SMART
BACK 205 307 7.49e-42 SMART
Kelch 355 400 3.31e-9 SMART
Kelch 401 447 3.82e-14 SMART
Kelch 448 494 1.49e-16 SMART
Kelch 495 543 8.58e-17 SMART
Kelch 544 590 4.93e-17 SMART
Kelch 591 638 4.16e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160860
AA Change: D511E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123701
Gene: ENSMUSG00000014164
AA Change: D511E

DomainStartEndE-ValueType
BTB 64 161 9.36e-30 SMART
BACK 166 268 7.49e-42 SMART
Kelch 316 361 3.31e-9 SMART
Kelch 362 408 3.82e-14 SMART
Kelch 409 455 1.49e-16 SMART
Kelch 456 504 8.58e-17 SMART
Kelch 505 551 4.93e-17 SMART
Kelch 552 599 4.16e-15 SMART
Meta Mutation Damage Score 0.1442 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and encodes a full-length protein which has an N-terminal BTB domain followed by a BACK domain and six kelch-like repeats in the C-terminus. These kelch-like repeats promote substrate ubiquitination of bound proteins via interaction of the BTB domain with the CUL3 (cullin 3) component of a cullin-RING E3 ubiquitin ligase (CRL) complex. Muatations in this gene cause pseudohypoaldosteronism type IID (PHA2D); a rare Mendelian syndrome featuring hypertension, hyperkalaemia and metabolic acidosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a point mutation display salt-sensitive hypertension, hyperkalemia and metabolic acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Klhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Klhl3 APN 13 58009422 critical splice acceptor site probably null
IGL01984:Klhl3 APN 13 58011243 splice site probably benign
IGL02022:Klhl3 APN 13 58051064 missense possibly damaging 0.95
IGL02543:Klhl3 APN 13 58018871 missense probably damaging 1.00
bearded_dragon UTSW 13 58011152 missense probably benign 0.00
R0975:Klhl3 UTSW 13 58013863 missense possibly damaging 0.81
R1386:Klhl3 UTSW 13 58030433 missense probably damaging 0.99
R1588:Klhl3 UTSW 13 58013898 missense probably damaging 1.00
R1791:Klhl3 UTSW 13 58033230 missense possibly damaging 0.87
R1894:Klhl3 UTSW 13 58009375 missense probably damaging 1.00
R1953:Klhl3 UTSW 13 58011208 missense probably damaging 1.00
R2116:Klhl3 UTSW 13 58018991 missense probably damaging 0.99
R3114:Klhl3 UTSW 13 58051027 critical splice donor site probably null
R4082:Klhl3 UTSW 13 58018797 missense probably null 1.00
R4717:Klhl3 UTSW 13 58030516 missense probably damaging 1.00
R4857:Klhl3 UTSW 13 58018806 missense probably damaging 1.00
R4934:Klhl3 UTSW 13 58102417 nonsense probably null
R5112:Klhl3 UTSW 13 58018889 missense probably damaging 1.00
R5114:Klhl3 UTSW 13 58018967 missense probably benign 0.24
R5547:Klhl3 UTSW 13 58102429 splice site probably null
R5776:Klhl3 UTSW 13 58005184 missense probably benign 0.00
R6236:Klhl3 UTSW 13 58085062 missense probably damaging 1.00
R6268:Klhl3 UTSW 13 58013842 missense probably damaging 1.00
R6457:Klhl3 UTSW 13 58100378 missense probably benign 0.01
R6559:Klhl3 UTSW 13 58016476 missense probably damaging 1.00
R6580:Klhl3 UTSW 13 58018887 missense possibly damaging 0.75
R6601:Klhl3 UTSW 13 58095116 missense probably damaging 0.96
R6904:Klhl3 UTSW 13 58030445 missense probably damaging 1.00
R7652:Klhl3 UTSW 13 58113332 start gained probably benign
R7979:Klhl3 UTSW 13 58063797 missense probably benign 0.39
R8112:Klhl3 UTSW 13 58013863 missense possibly damaging 0.81
R8114:Klhl3 UTSW 13 58013863 missense possibly damaging 0.81
R8270:Klhl3 UTSW 13 58113154 missense
R8409:Klhl3 UTSW 13 58019428 missense probably damaging 1.00
Z1177:Klhl3 UTSW 13 58009409 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGCCACTCTTATGTTCAGGAC -3'
(R):5'- GAACCTCCTTATTTGCAGGCTG -3'

Sequencing Primer
(F):5'- CACTCTTATGTTCAGGACACAGGG -3'
(R):5'- TTTACAGATTAGGGCAATGAGGTCC -3'
Posted On2018-07-24