Incidental Mutation 'R6669:Tox4'
ID528071
Institutional Source Beutler Lab
Gene Symbol Tox4
Ensembl Gene ENSMUSG00000016831
Gene NameTOX high mobility group box family member 4
Synonyms5730589K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6669 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52279146-52296401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52286756 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 116 (Y116H)
Ref Sequence ENSEMBL: ENSMUSP00000022766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022766]
Predicted Effect probably damaging
Transcript: ENSMUST00000022766
AA Change: Y116H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022766
Gene: ENSMUSG00000016831
AA Change: Y116H

DomainStartEndE-ValueType
low complexity region 146 160 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
HMG 222 292 1.17e-18 SMART
low complexity region 307 339 N/A INTRINSIC
low complexity region 435 476 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173361
Meta Mutation Damage Score 0.3879 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Tox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tox4 APN 14 52285745 missense probably damaging 1.00
Gift UTSW 14 52286756 missense probably damaging 1.00
PIT4494001:Tox4 UTSW 14 52291803 missense possibly damaging 0.71
R0517:Tox4 UTSW 14 52292628 missense probably benign 0.01
R0801:Tox4 UTSW 14 52279878 missense probably benign 0.28
R1640:Tox4 UTSW 14 52292543 missense possibly damaging 0.53
R2980:Tox4 UTSW 14 52292526 missense probably benign 0.00
R3899:Tox4 UTSW 14 52279842 missense probably damaging 0.98
R4016:Tox4 UTSW 14 52285904 critical splice donor site probably null
R4614:Tox4 UTSW 14 52287467 missense probably damaging 0.99
R5764:Tox4 UTSW 14 52285820 missense probably damaging 0.96
R5847:Tox4 UTSW 14 52286784 missense probably damaging 0.99
R6978:Tox4 UTSW 14 52287237 splice site probably null
R7155:Tox4 UTSW 14 52292097 missense probably benign
R7770:Tox4 UTSW 14 52279842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGGATTGTGGGGAATG -3'
(R):5'- TTGAAAGACGATCCTCAGGTG -3'

Sequencing Primer
(F):5'- TTCACATAGGTAGATCAGGCTAGCC -3'
(R):5'- GTGACTGGGCAGGTGGC -3'
Posted On2018-07-24