Incidental Mutation 'R6669:Mocos'
List |< first << previous [record 19 of 34] next >> last >|
ID528074
Institutional Source Beutler Lab
Gene Symbol Mocos
Ensembl Gene ENSMUSG00000039616
Gene Namemolybdenum cofactor sulfurase
Synonyms1110018O12Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_026779.1; MGI:1915841

Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R6669 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location24653691-24701556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24666410 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 234 (F234I)
Ref Sequence ENSEMBL: ENSMUSP00000063609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068006]
Predicted Effect probably damaging
Transcript: ENSMUST00000068006
AA Change: F234I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063609
Gene: ENSMUSG00000039616
AA Change: F234I

DomainStartEndE-ValueType
Pfam:Aminotran_5 50 481 7.5e-29 PFAM
Pfam:MOSC_N 569 689 1.1e-32 PFAM
Pfam:MOSC 715 853 3.7e-21 PFAM
Meta Mutation Damage Score 0.3751 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MOCOS sulfurates the molybdenum cofactor of xanthine dehydrogenase (XDH; MIM 607633) and aldehyde oxidase (AOX1; MIM 602841), which is required for their enzymatic activities (Ichida et al., 2001 [PubMed 11302742]).[supplied by OMIM, Feb 2010]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Mocos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Mocos APN 18 24660044 missense possibly damaging 0.88
IGL01859:Mocos APN 18 24666660 splice site probably benign
IGL01884:Mocos APN 18 24683216 missense probably damaging 1.00
IGL02174:Mocos APN 18 24695896 missense probably benign 0.00
IGL02966:Mocos APN 18 24676611 missense probably damaging 1.00
IGL02976:Mocos APN 18 24666569 missense possibly damaging 0.92
P0008:Mocos UTSW 18 24679606 missense probably benign 0.32
PIT4810001:Mocos UTSW 18 24686702 missense probably damaging 1.00
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0132:Mocos UTSW 18 24679762 missense probably benign 0.01
R0265:Mocos UTSW 18 24666276 missense probably benign 0.01
R0737:Mocos UTSW 18 24688987 missense probably damaging 0.98
R1231:Mocos UTSW 18 24679701 missense probably benign 0.01
R1351:Mocos UTSW 18 24660050 missense probably damaging 1.00
R1699:Mocos UTSW 18 24683216 missense probably damaging 1.00
R1853:Mocos UTSW 18 24695969 missense probably damaging 1.00
R2190:Mocos UTSW 18 24664057 missense probably benign 0.01
R2350:Mocos UTSW 18 24666656 splice site probably benign
R2680:Mocos UTSW 18 24676629 missense probably damaging 1.00
R3840:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3841:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3847:Mocos UTSW 18 24676662 missense probably damaging 0.99
R4059:Mocos UTSW 18 24679390 missense probably damaging 1.00
R4158:Mocos UTSW 18 24674246 missense probably damaging 0.99
R4205:Mocos UTSW 18 24666191 missense possibly damaging 0.88
R4514:Mocos UTSW 18 24683212 missense probably damaging 0.99
R4589:Mocos UTSW 18 24654038 missense probably damaging 0.99
R4667:Mocos UTSW 18 24666434 missense probably benign 0.11
R4668:Mocos UTSW 18 24666434 missense probably benign 0.11
R5162:Mocos UTSW 18 24654052 missense probably damaging 0.98
R5187:Mocos UTSW 18 24692554 missense probably damaging 0.97
R5533:Mocos UTSW 18 24674300 missense probably damaging 1.00
R5629:Mocos UTSW 18 24664085 critical splice donor site probably null
R5661:Mocos UTSW 18 24665995 splice site probably null
R5952:Mocos UTSW 18 24701387 missense possibly damaging 0.91
R5987:Mocos UTSW 18 24686693 missense probably damaging 1.00
R6173:Mocos UTSW 18 24676582 missense probably benign 0.03
R6209:Mocos UTSW 18 24666615 missense probably benign 0.41
R6376:Mocos UTSW 18 24701485 missense possibly damaging 0.50
R6416:Mocos UTSW 18 24701456 missense probably damaging 0.99
R6452:Mocos UTSW 18 24695941 missense probably benign 0.02
R6520:Mocos UTSW 18 24666390 missense probably benign 0.01
R6631:Mocos UTSW 18 24699931 missense probably benign 0.03
R7114:Mocos UTSW 18 24666515 missense probably damaging 1.00
R7366:Mocos UTSW 18 24676616 missense probably damaging 1.00
R7690:Mocos UTSW 18 24664025 missense probably damaging 1.00
R7955:Mocos UTSW 18 24666159 missense probably damaging 1.00
R8458:Mocos UTSW 18 24666257 missense probably benign 0.00
Z1176:Mocos UTSW 18 24670633 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCAGAGGACATGTGGTC -3'
(R):5'- GACGTAAAAGTCCTCTCCTGCAAG -3'

Sequencing Primer
(F):5'- CATGTGGTCAGCGGAGG -3'
(R):5'- TAAAAGTCCTCTCCTGCAAGGTAGG -3'
Posted On2018-07-24