Incidental Mutation 'R6652:Espnl'
ID528077
Institutional Source Beutler Lab
Gene Symbol Espnl
Ensembl Gene ENSMUSG00000049515
Gene Nameespin-like
SynonymsLOC227357
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6652 (G1)
Quality Score177.009
Status Validated
Chromosome1
Chromosomal Location91322075-91348306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 91344699 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 594 (I594L)
Ref Sequence ENSEMBL: ENSMUSP00000086294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088904] [ENSMUST00000176156]
Predicted Effect probably benign
Transcript: ENSMUST00000088904
AA Change: I594L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000086294
Gene: ENSMUSG00000049515
AA Change: I594L

DomainStartEndE-ValueType
Blast:ANK 1 33 4e-7 BLAST
ANK 35 64 5.21e1 SMART
ANK 69 102 2.88e2 SMART
ANK 103 132 3.85e-2 SMART
ANK 136 166 7.08e-1 SMART
ANK 170 200 1.02e-1 SMART
ANK 204 232 3.04e0 SMART
ANK 238 267 5.01e-1 SMART
ANK 270 299 1.96e-3 SMART
ANK 303 332 3.21e1 SMART
low complexity region 336 345 N/A INTRINSIC
coiled coil region 509 538 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176156
AA Change: I550L

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135828
Gene: ENSMUSG00000049515
AA Change: I550L

DomainStartEndE-ValueType
Blast:ANK 1 33 5e-7 BLAST
ANK 35 64 5.21e1 SMART
ANK 69 102 2.88e2 SMART
ANK 103 132 3.85e-2 SMART
ANK 136 166 7.08e-1 SMART
ANK 170 200 1.02e-1 SMART
ANK 204 232 3.04e0 SMART
ANK 238 267 5.01e-1 SMART
low complexity region 292 301 N/A INTRINSIC
coiled coil region 465 494 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Espnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Espnl APN 1 91340611 nonsense probably null
IGL01726:Espnl APN 1 91344904 missense probably benign
IGL02402:Espnl APN 1 91344813 missense probably benign 0.13
IGL02472:Espnl APN 1 91340534 missense probably benign 0.02
IGL02986:Espnl APN 1 91344850 missense probably benign 0.01
IGL03037:Espnl APN 1 91341921 missense probably benign 0.01
IGL03073:Espnl APN 1 91344556 missense probably damaging 0.99
R0111:Espnl UTSW 1 91344742 missense probably benign 0.29
R0197:Espnl UTSW 1 91344489 missense probably damaging 1.00
R0238:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0239:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0239:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0665:Espnl UTSW 1 91334687 splice site probably null
R1772:Espnl UTSW 1 91344603 missense possibly damaging 0.61
R3804:Espnl UTSW 1 91322221 missense probably benign 0.00
R4352:Espnl UTSW 1 91334721 missense probably damaging 1.00
R4566:Espnl UTSW 1 91344579 missense possibly damaging 0.46
R4790:Espnl UTSW 1 91344424 missense probably damaging 1.00
R5234:Espnl UTSW 1 91344793 missense probably benign 0.02
R6430:Espnl UTSW 1 91322248 missense possibly damaging 0.75
R6785:Espnl UTSW 1 91322221 missense probably benign 0.00
R6800:Espnl UTSW 1 91342629 missense probably damaging 0.98
R7082:Espnl UTSW 1 91334799 missense probably benign 0.00
R7311:Espnl UTSW 1 91323568 missense probably damaging 0.98
R7376:Espnl UTSW 1 91322314 missense probably damaging 1.00
R7880:Espnl UTSW 1 91344766 missense possibly damaging 0.81
R8154:Espnl UTSW 1 91325199 missense possibly damaging 0.87
Z1177:Espnl UTSW 1 91323555 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCAGATCAACGACCTG -3'
(R):5'- AACTGACACTCCGCACTCTTG -3'

Sequencing Primer
(F):5'- GACGCTGCCAGGAGTATG -3'
(R):5'- ACTCTTGGATCTCGCGCTGG -3'
Posted On2018-07-24