Incidental Mutation 'R6652:Fhdc1'
ID528082
Institutional Source Beutler Lab
Gene Symbol Fhdc1
Ensembl Gene ENSMUSG00000041842
Gene NameFH2 domain containing 1
Synonyms6330505N24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location84442198-84480429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84464324 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 108 (Y108C)
Ref Sequence ENSEMBL: ENSMUSP00000142030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091002] [ENSMUST00000107689] [ENSMUST00000194027]
Predicted Effect probably damaging
Transcript: ENSMUST00000091002
AA Change: Y205C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088525
Gene: ENSMUSG00000041842
AA Change: Y205C

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107689
AA Change: Y205C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103317
Gene: ENSMUSG00000041842
AA Change: Y205C

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194027
AA Change: Y108C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142030
Gene: ENSMUSG00000041842
AA Change: Y108C

DomainStartEndE-ValueType
Pfam:FH2 1 145 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Fhdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Fhdc1 APN 3 84448800 missense probably damaging 1.00
IGL00556:Fhdc1 APN 3 84457242 missense possibly damaging 0.81
IGL00951:Fhdc1 APN 3 84464313 missense possibly damaging 0.90
IGL01744:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01754:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01762:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01764:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01769:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01778:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01779:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01781:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02243:Fhdc1 APN 3 84474640 start codon destroyed possibly damaging 0.89
IGL02260:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02261:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02266:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02271:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02284:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02292:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02296:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02301:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02347:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02416:Fhdc1 APN 3 84445228 missense probably benign 0.03
IGL03189:Fhdc1 APN 3 84455061 intron probably benign
IGL03392:Fhdc1 APN 3 84444519 missense possibly damaging 0.55
R0125:Fhdc1 UTSW 3 84445545 missense probably benign
R0135:Fhdc1 UTSW 3 84445618 missense probably damaging 0.97
R0255:Fhdc1 UTSW 3 84453510 intron probably benign
R0401:Fhdc1 UTSW 3 84444624 missense probably benign 0.02
R1371:Fhdc1 UTSW 3 84445003 missense probably damaging 1.00
R1727:Fhdc1 UTSW 3 84446176 missense possibly damaging 0.50
R1769:Fhdc1 UTSW 3 84448778 missense probably damaging 1.00
R1781:Fhdc1 UTSW 3 84448804 missense probably damaging 0.99
R1840:Fhdc1 UTSW 3 84445821 missense possibly damaging 0.46
R1970:Fhdc1 UTSW 3 84454851 missense probably damaging 1.00
R2038:Fhdc1 UTSW 3 84444561 missense probably benign 0.22
R2088:Fhdc1 UTSW 3 84474726 start gained probably benign
R2256:Fhdc1 UTSW 3 84446046 missense probably benign
R2939:Fhdc1 UTSW 3 84457270 missense possibly damaging 0.47
R3813:Fhdc1 UTSW 3 84464270 critical splice donor site probably null
R4022:Fhdc1 UTSW 3 84445102 missense probably benign 0.01
R4175:Fhdc1 UTSW 3 84456987 intron probably benign
R4243:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4245:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4290:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4291:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4292:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4293:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4294:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4295:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4334:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4335:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4342:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4344:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4354:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4550:Fhdc1 UTSW 3 84445176 missense probably benign 0.16
R4626:Fhdc1 UTSW 3 84474250 missense probably damaging 1.00
R4925:Fhdc1 UTSW 3 84453533 missense probably damaging 1.00
R5155:Fhdc1 UTSW 3 84446150 missense probably benign 0.00
R5588:Fhdc1 UTSW 3 84465476 missense possibly damaging 0.91
R6043:Fhdc1 UTSW 3 84448886 missense probably damaging 0.96
R6063:Fhdc1 UTSW 3 84446029 missense probably benign 0.00
R6706:Fhdc1 UTSW 3 84446422 missense probably damaging 1.00
R6783:Fhdc1 UTSW 3 84445527 missense probably benign 0.00
R6984:Fhdc1 UTSW 3 84444516 missense possibly damaging 0.93
R7182:Fhdc1 UTSW 3 84448850 missense probably damaging 0.98
R7299:Fhdc1 UTSW 3 84444540 missense probably damaging 1.00
R7574:Fhdc1 UTSW 3 84446131 missense probably benign
R7765:Fhdc1 UTSW 3 84444599 missense probably benign 0.04
R8013:Fhdc1 UTSW 3 84474639 start codon destroyed probably null 0.99
R8014:Fhdc1 UTSW 3 84474639 start codon destroyed probably null 0.99
R8139:Fhdc1 UTSW 3 84451483 missense probably damaging 1.00
R8264:Fhdc1 UTSW 3 84455032 missense probably damaging 1.00
R8384:Fhdc1 UTSW 3 84454999 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAGCCTGGCTCTTTCTATCG -3'
(R):5'- TCCTCAGAACCCGGAAGAAG -3'

Sequencing Primer
(F):5'- ATTTTGACATGAGACCCTTCTGAC -3'
(R):5'- ACCCGGAAGAAGCAAGC -3'
Posted On2018-07-24