Incidental Mutation 'R6652:Ubap2'
ID528084
Institutional Source Beutler Lab
Gene Symbol Ubap2
Ensembl Gene ENSMUSG00000028433
Gene Nameubiquitin-associated protein 2
Synonyms1190005K07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41194313-41275144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41196743 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 872 (N872K)
Ref Sequence ENSEMBL: ENSMUSP00000103703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000040008] [ENSMUST00000108068]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030143
AA Change: N873K

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433
AA Change: N873K

DomainStartEndE-ValueType
UBA 53 91 9.62e-8 SMART
low complexity region 115 127 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 256 266 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Pfam:DUF3697 512 544 1.5e-18 PFAM
low complexity region 583 618 N/A INTRINSIC
low complexity region 631 644 N/A INTRINSIC
low complexity region 696 722 N/A INTRINSIC
low complexity region 744 768 N/A INTRINSIC
low complexity region 787 800 N/A INTRINSIC
low complexity region 888 914 N/A INTRINSIC
low complexity region 1007 1024 N/A INTRINSIC
low complexity region 1057 1078 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
low complexity region 1101 1115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040008
SMART Domains Protein: ENSMUSP00000038813
Gene: ENSMUSG00000036241

DomainStartEndE-ValueType
UBCc 11 174 1.55e-65 SMART
low complexity region 204 232 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108068
AA Change: N872K

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433
AA Change: N872K

DomainStartEndE-ValueType
UBA 52 90 9.62e-8 SMART
low complexity region 114 126 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
Pfam:DUF3697 511 543 1.2e-20 PFAM
low complexity region 582 617 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 695 721 N/A INTRINSIC
low complexity region 743 767 N/A INTRINSIC
low complexity region 786 799 N/A INTRINSIC
low complexity region 887 913 N/A INTRINSIC
low complexity region 1006 1023 N/A INTRINSIC
low complexity region 1056 1077 N/A INTRINSIC
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136057
SMART Domains Protein: ENSMUSP00000120205
Gene: ENSMUSG00000028433

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 49 70 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143552
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Ubap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2 APN 4 41195328 splice site probably benign
IGL01109:Ubap2 APN 4 41195155 missense probably damaging 1.00
IGL01354:Ubap2 APN 4 41207005 missense probably damaging 1.00
IGL01563:Ubap2 APN 4 41195998 missense probably damaging 0.96
IGL01602:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01605:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01688:Ubap2 APN 4 41226308 missense probably benign
IGL01733:Ubap2 APN 4 41195862 unclassified probably benign
IGL01896:Ubap2 APN 4 41202362 missense possibly damaging 0.85
IGL01942:Ubap2 APN 4 41251608 missense probably benign 0.00
IGL02095:Ubap2 APN 4 41229709 missense probably benign
R0608:Ubap2 UTSW 4 41218319 missense probably benign 0.10
R0938:Ubap2 UTSW 4 41202304 missense probably damaging 1.00
R1449:Ubap2 UTSW 4 41209351 critical splice donor site probably null
R1484:Ubap2 UTSW 4 41235593 missense probably damaging 1.00
R1548:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1549:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1604:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1607:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1739:Ubap2 UTSW 4 41206849 missense probably benign 0.00
R1772:Ubap2 UTSW 4 41202380 missense probably benign 0.02
R1862:Ubap2 UTSW 4 41221607 missense probably benign
R1869:Ubap2 UTSW 4 41233617 missense probably damaging 1.00
R1886:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1887:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2063:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2064:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2065:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2066:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2095:Ubap2 UTSW 4 41206901 missense possibly damaging 0.68
R2214:Ubap2 UTSW 4 41199714 critical splice donor site probably null
R2215:Ubap2 UTSW 4 41196483 splice site probably null
R2318:Ubap2 UTSW 4 41251542 missense probably damaging 0.99
R3755:Ubap2 UTSW 4 41195482 missense probably damaging 1.00
R4620:Ubap2 UTSW 4 41233698 missense probably damaging 1.00
R4717:Ubap2 UTSW 4 41218333 missense possibly damaging 0.93
R4756:Ubap2 UTSW 4 41211771 missense probably damaging 1.00
R4942:Ubap2 UTSW 4 41245461 intron probably benign
R5344:Ubap2 UTSW 4 41251578 missense possibly damaging 0.46
R5763:Ubap2 UTSW 4 41195809 missense probably damaging 1.00
R5851:Ubap2 UTSW 4 41206268 nonsense probably null
R5951:Ubap2 UTSW 4 41205753 splice site probably null
R6178:Ubap2 UTSW 4 41206981 missense probably benign
R6489:Ubap2 UTSW 4 41203574 critical splice acceptor site probably null
R6520:Ubap2 UTSW 4 41195155 missense probably damaging 1.00
R6702:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227224 small insertion probably benign
R6860:Ubap2 UTSW 4 41233631 missense probably damaging 1.00
R7007:Ubap2 UTSW 4 41206221 missense probably damaging 0.97
R7048:Ubap2 UTSW 4 41196033 missense possibly damaging 0.49
R7121:Ubap2 UTSW 4 41205550 missense probably benign 0.00
R7371:Ubap2 UTSW 4 41195779 missense probably benign 0.16
R7378:Ubap2 UTSW 4 41235515 critical splice donor site probably null
R7695:Ubap2 UTSW 4 41211740 missense probably damaging 0.98
R7811:Ubap2 UTSW 4 41211710 missense probably benign 0.22
R7828:Ubap2 UTSW 4 41221615 missense probably benign 0.00
R7838:Ubap2 UTSW 4 41233655 missense probably damaging 1.00
R8016:Ubap2 UTSW 4 41195201 missense possibly damaging 0.91
X0061:Ubap2 UTSW 4 41196507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTGTGACGTCACCTAGAAG -3'
(R):5'- TTCTGGGAGTGTGGCATCAC -3'

Sequencing Primer
(F):5'- ACGACCCTTGTATTACCAGGG -3'
(R):5'- ACCCAGAGTGTGCATACATGTTC -3'
Posted On2018-07-24