Incidental Mutation 'R6652:Nadsyn1'
ID528092
Institutional Source Beutler Lab
Gene Symbol Nadsyn1
Ensembl Gene ENSMUSG00000031090
Gene NameNAD synthetase 1
Synonyms9130012B15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location143795584-143822849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143811218 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 250 (M250K)
Ref Sequence ENSEMBL: ENSMUSP00000033415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033415] [ENSMUST00000132520] [ENSMUST00000143366] [ENSMUST00000156638] [ENSMUST00000156779]
Predicted Effect probably benign
Transcript: ENSMUST00000033415
AA Change: M250K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000033415
Gene: ENSMUSG00000031090
AA Change: M250K

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 283 3.2e-52 PFAM
Pfam:NAD_synthase 337 649 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132520
AA Change: M250K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000114380
Gene: ENSMUSG00000031090
AA Change: M250K

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 201 6.3e-39 PFAM
Pfam:NAD_synthase 336 561 8.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143210
Predicted Effect probably benign
Transcript: ENSMUST00000143366
SMART Domains Protein: ENSMUSP00000115857
Gene: ENSMUSG00000031090

DomainStartEndE-ValueType
SCOP:d1f89a_ 1 28 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156638
SMART Domains Protein: ENSMUSP00000114889
Gene: ENSMUSG00000031090

DomainStartEndE-ValueType
SCOP:d1f89a_ 1 28 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156779
SMART Domains Protein: ENSMUSP00000120220
Gene: ENSMUSG00000031090

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 54 8.3e-9 PFAM
Meta Mutation Damage Score 0.3140 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC 6.3.5.1) catalyzes the final step in the biosynthesis of NAD from nicotinic acid adenine dinucleotide (NaAD).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Nadsyn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Nadsyn1 APN 7 143812793 missense probably damaging 1.00
IGL01359:Nadsyn1 APN 7 143821230 missense possibly damaging 0.74
IGL01412:Nadsyn1 APN 7 143808790 critical splice donor site probably null
IGL01481:Nadsyn1 APN 7 143812584 missense probably damaging 1.00
IGL01642:Nadsyn1 APN 7 143797878 missense probably damaging 1.00
IGL02110:Nadsyn1 APN 7 143813427 missense probably damaging 1.00
IGL02126:Nadsyn1 APN 7 143804016 nonsense probably null
IGL02173:Nadsyn1 APN 7 143804006 splice site probably benign
IGL02351:Nadsyn1 APN 7 143799912 missense probably damaging 1.00
IGL02358:Nadsyn1 APN 7 143799912 missense probably damaging 1.00
IGL03216:Nadsyn1 APN 7 143797845 missense probably damaging 1.00
R0029:Nadsyn1 UTSW 7 143806078 missense probably benign 0.01
R0036:Nadsyn1 UTSW 7 143811291 missense probably benign 0.23
R0968:Nadsyn1 UTSW 7 143806033 missense probably benign 0.30
R1487:Nadsyn1 UTSW 7 143806925 missense probably benign 0.31
R1694:Nadsyn1 UTSW 7 143808012 missense probably benign 0.00
R1874:Nadsyn1 UTSW 7 143797844 missense probably damaging 1.00
R4540:Nadsyn1 UTSW 7 143803223 missense probably damaging 1.00
R4742:Nadsyn1 UTSW 7 143798630 intron probably benign
R4755:Nadsyn1 UTSW 7 143806913 missense probably damaging 1.00
R5045:Nadsyn1 UTSW 7 143806969 missense probably damaging 1.00
R5288:Nadsyn1 UTSW 7 143803286 missense possibly damaging 0.95
R5326:Nadsyn1 UTSW 7 143808830 missense probably benign 0.42
R5666:Nadsyn1 UTSW 7 143807431 missense probably damaging 1.00
R5669:Nadsyn1 UTSW 7 143807431 missense probably damaging 1.00
R5691:Nadsyn1 UTSW 7 143812579 splice site probably null
R5861:Nadsyn1 UTSW 7 143811227 missense possibly damaging 0.80
R6213:Nadsyn1 UTSW 7 143799812 missense probably benign 0.05
R6624:Nadsyn1 UTSW 7 143805973 missense probably benign 0.02
R6791:Nadsyn1 UTSW 7 143819108 missense probably damaging 1.00
R7144:Nadsyn1 UTSW 7 143811215 missense probably damaging 0.99
R7559:Nadsyn1 UTSW 7 143808067 missense probably benign 0.00
R7770:Nadsyn1 UTSW 7 143806003 missense probably damaging 1.00
R7802:Nadsyn1 UTSW 7 143806026 missense probably benign
R7871:Nadsyn1 UTSW 7 143798496 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGTTCAGCCAAAACATGTCCTAG -3'
(R):5'- CAGAGTCTGGATGCCAATAGC -3'

Sequencing Primer
(F):5'- ACTTGGCAGTGTGAAGGT -3'
(R):5'- AGAATGGCAGTCTGGTGCATC -3'
Posted On2018-07-24