Incidental Mutation 'R6652:Stoml1'
ID528098
Institutional Source Beutler Lab
Gene Symbol Stoml1
Ensembl Gene ENSMUSG00000032333
Gene Namestomatin-like 1
Synonyms1810015E19Rik, WPB72, UNC-24, SLP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location58253164-58262520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58256734 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 112 (D112G)
Ref Sequence ENSEMBL: ENSMUSP00000034883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034883] [ENSMUST00000215488] [ENSMUST00000216864] [ENSMUST00000216877] [ENSMUST00000217165]
Predicted Effect probably damaging
Transcript: ENSMUST00000034883
AA Change: D112G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034883
Gene: ENSMUSG00000032333
AA Change: D112G

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
PHB 77 237 7.08e-42 SMART
Pfam:SCP2 292 396 7.2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215079
Predicted Effect probably benign
Transcript: ENSMUST00000215488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216187
Predicted Effect probably benign
Transcript: ENSMUST00000216864
Predicted Effect probably benign
Transcript: ENSMUST00000216877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217026
Predicted Effect probably benign
Transcript: ENSMUST00000217165
Meta Mutation Damage Score 0.8034 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele are viable and free of overt neurological phenotypes but show a mild, but specific, disinhibition of certain proton-gated currents in dorsal root ganglia neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Stoml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Stoml1 APN 9 58256713 missense probably damaging 0.96
IGL02693:Stoml1 APN 9 58257076 missense probably damaging 0.99
IGL03180:Stoml1 APN 9 58260917 missense probably damaging 1.00
R1464:Stoml1 UTSW 9 58260426 unclassified probably benign
R5632:Stoml1 UTSW 9 58253370 missense probably damaging 1.00
R5836:Stoml1 UTSW 9 58260840 missense probably benign
R6558:Stoml1 UTSW 9 58256668 missense probably damaging 1.00
R6881:Stoml1 UTSW 9 58260894 missense probably damaging 1.00
R7006:Stoml1 UTSW 9 58260240 missense probably damaging 0.96
R7607:Stoml1 UTSW 9 58256658 missense probably damaging 1.00
X0020:Stoml1 UTSW 9 58260801 missense probably benign 0.08
X0058:Stoml1 UTSW 9 58257166 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGTTGACTTCTGGCCTAC -3'
(R):5'- GCAAAATGTTACCTCCAAGAAGGC -3'

Sequencing Primer
(F):5'- CGAAGGGCATTTGACTGGC -3'
(R):5'- TGTTACCTCCAAGAAGGCAGAGC -3'
Posted On2018-07-24