Mutagenetix > Incidental Mutation

Incidental Mutation 'R6652:Kidins220'

528105

Institutional Source

Beutler Lab

Gene Symbol

Kidins220

Ensembl Gene

ENSMUSG00000036333

Gene Name

kinase D-interacting substrate 220

Synonyms

C330002I19Rik, 3110039L19Rik

MMRRC Submission

044773-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6652 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25024924-25113151 bp(+) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 25060059 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]

AlphaFold

E9Q9B7

Predicted Effect

probably null
Transcript: ENSMUST00000066652

SMART Domains

Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333

Domain	Start	End	E-Value	Type
ANK	37	66	1.11e-7	SMART
ANK	70	99	2.25e-3	SMART
ANK	103	132	4.78e-7	SMART
ANK	136	165	5.53e-3	SMART
ANK	169	198	2.52e-6	SMART
ANK	202	231	6.26e-2	SMART
ANK	235	264	1.22e-4	SMART
ANK	268	297	6.92e-4	SMART
ANK	301	330	1.57e-2	SMART
ANK	334	363	9.78e-4	SMART
ANK	367	398	4.6e0	SMART
Pfam:KAP_NTPase	440	953	1.2e-112	PFAM
low complexity region	1077	1092	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1382	1396	N/A	INTRINSIC
low complexity region	1422	1452	N/A	INTRINSIC
low complexity region	1509	1520	N/A	INTRINSIC
low complexity region	1544	1555	N/A	INTRINSIC
low complexity region	1561	1567	N/A	INTRINSIC
low complexity region	1596	1609	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000220459

Predicted Effect

probably null
Transcript: ENSMUST00000222013

Predicted Effect

probably null
Transcript: ENSMUST00000222941

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.7%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	G	7: 119,846,164 (GRCm39)	D605G	probably damaging	Het
Cfh	A	T	1: 140,071,806 (GRCm39)	I294N	probably benign	Het
Clk3	A	G	9: 57,669,078 (GRCm39)	S49P	probably damaging	Het
Cmya5	A	G	13: 93,229,403 (GRCm39)	V1895A	probably benign	Het
Cmya5	T	C	13: 93,229,547 (GRCm39)	D1847G	probably damaging	Het
Cwf19l1	T	C	19: 44,103,138 (GRCm39)	D359G	probably benign	Het
Dag1	A	T	9: 108,086,289 (GRCm39)	M284K	probably damaging	Het
Ergic2	T	C	6: 148,091,079 (GRCm39)	Y211C	probably damaging	Het
Espnl	A	C	1: 91,272,421 (GRCm39)	I594L	probably benign	Het
Fam193b	A	G	13: 55,690,603 (GRCm39)	S226P	probably damaging	Het
Fat2	T	A	11: 55,143,088 (GRCm39)	I4254L	probably benign	Het
Fhdc1	T	C	3: 84,371,631 (GRCm39)	Y108C	probably damaging	Het
Fut9	G	C	4: 25,620,619 (GRCm39)	T65S	probably benign	Het
Gm9507	A	T	10: 77,647,493 (GRCm39)		probably benign	Het
Gpt2	G	A	8: 86,244,681 (GRCm39)	E325K	probably benign	Het
Grap2	A	T	15: 80,532,723 (GRCm39)	N297Y	probably damaging	Het
Igfn1	A	G	1: 135,891,609 (GRCm39)	F2302S	probably damaging	Het
Ighv1-81	T	A	12: 115,884,051 (GRCm39)	I67F	probably damaging	Het
Kti12	T	A	4: 108,705,730 (GRCm39)	S215T	probably benign	Het
Mc1r	G	A	8: 124,134,370 (GRCm39)	G41D	probably damaging	Het
Mov10l1	A	G	15: 88,878,105 (GRCm39)	Y129C	probably damaging	Het
Mthfsd	A	T	8: 121,825,560 (GRCm39)	L337Q	probably damaging	Het
Musk	C	T	4: 58,368,977 (GRCm39)	A629V	probably damaging	Het
Nadsyn1	A	T	7: 143,364,955 (GRCm39)	M250K	probably benign	Het
Ncapd2	G	A	6: 125,163,233 (GRCm39)	H92Y	probably benign	Het
Or4e5	C	T	14: 52,728,250 (GRCm39)	R57Q	probably benign	Het
Or6y1	G	A	1: 174,276,627 (GRCm39)	C146Y	probably damaging	Het
Plec	A	T	15: 76,063,974 (GRCm39)	V2100E	probably damaging	Het
Prss37	C	A	6: 40,496,090 (GRCm39)		probably benign	Het
Sebox	A	T	11: 78,394,631 (GRCm39)	E32V	probably damaging	Het
Senp7	C	A	16: 55,944,257 (GRCm39)	Q194K	probably benign	Het
Sfxn3	G	A	19: 45,038,354 (GRCm39)		probably null	Het
Spart	G	A	3: 55,032,248 (GRCm39)	E361K	probably benign	Het
Stn1	T	C	19: 47,496,017 (GRCm39)	T334A	probably benign	Het
Stoml1	A	G	9: 58,164,017 (GRCm39)	D112G	probably damaging	Het
Thap2	T	A	10: 115,212,441 (GRCm39)	D28V	probably damaging	Het
Ubap2	A	T	4: 41,196,743 (GRCm39)	N872K	possibly damaging	Het
Vezt	A	G	10: 93,806,141 (GRCm39)	F757L	probably damaging	Het
Vmn1r204	T	C	13: 22,740,573 (GRCm39)	I68T	probably damaging	Het
Wnt10a	A	G	1: 74,842,613 (GRCm39)		probably null	Het
Yipf7	A	G	5: 69,698,504 (GRCm39)	M1T	probably null	Het
Zdhhc19	T	C	16: 32,316,047 (GRCm39)	F48S	probably damaging	Het
Zfp317	C	T	9: 19,558,335 (GRCm39)	T183I	probably damaging	Het

Other mutations in Kidins220

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Kidins220	APN	12	25,088,559 (GRCm39)	splice site	probably benign
IGL00959:Kidins220	APN	12	25,101,132 (GRCm39)	missense	possibly damaging	0.74
IGL00978:Kidins220	APN	12	25,107,473 (GRCm39)	missense	probably damaging	1.00
IGL01144:Kidins220	APN	12	25,060,925 (GRCm39)	missense	probably damaging	1.00
IGL01326:Kidins220	APN	12	25,088,498 (GRCm39)	missense	probably damaging	0.97
IGL01545:Kidins220	APN	12	25,090,459 (GRCm39)	missense	possibly damaging	0.66
IGL01802:Kidins220	APN	12	25,044,999 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kidins220	APN	12	25,107,728 (GRCm39)	missense	probably benign	0.00
IGL02160:Kidins220	APN	12	25,054,110 (GRCm39)	missense	probably damaging	1.00
IGL02383:Kidins220	APN	12	25,047,332 (GRCm39)	splice site	probably benign
IGL02673:Kidins220	APN	12	25,044,991 (GRCm39)	missense	probably damaging	1.00
IGL02800:Kidins220	APN	12	25,053,092 (GRCm39)	missense	probably damaging	1.00
IGL03345:Kidins220	APN	12	25,053,044 (GRCm39)	missense	probably damaging	1.00
IGL03379:Kidins220	APN	12	25,058,447 (GRCm39)	missense	probably damaging	0.99
IGL03412:Kidins220	APN	12	25,049,344 (GRCm39)	missense	probably damaging	1.00
P0043:Kidins220	UTSW	12	25,058,155 (GRCm39)	missense	probably damaging	1.00
R0011:Kidins220	UTSW	12	25,049,351 (GRCm39)	missense	probably damaging	0.99
R0011:Kidins220	UTSW	12	25,049,351 (GRCm39)	missense	probably damaging	0.99
R0269:Kidins220	UTSW	12	25,090,511 (GRCm39)	missense	probably damaging	0.98
R0280:Kidins220	UTSW	12	25,060,140 (GRCm39)	missense	probably damaging	1.00
R0334:Kidins220	UTSW	12	25,058,068 (GRCm39)	missense	probably damaging	1.00
R1601:Kidins220	UTSW	12	25,055,087 (GRCm39)	missense	probably benign	0.35
R1778:Kidins220	UTSW	12	25,063,445 (GRCm39)	splice site	probably benign
R1808:Kidins220	UTSW	12	25,053,008 (GRCm39)	missense	probably benign	0.00
R1855:Kidins220	UTSW	12	25,106,590 (GRCm39)	missense	probably damaging	1.00
R1965:Kidins220	UTSW	12	25,044,905 (GRCm39)	missense	probably damaging	1.00
R1982:Kidins220	UTSW	12	25,101,193 (GRCm39)	missense	probably benign	0.01
R2069:Kidins220	UTSW	12	25,037,005 (GRCm39)	splice site	probably benign
R2101:Kidins220	UTSW	12	25,107,422 (GRCm39)	missense	probably damaging	1.00
R2124:Kidins220	UTSW	12	25,091,302 (GRCm39)	critical splice donor site	probably null
R2371:Kidins220	UTSW	12	25,107,323 (GRCm39)	missense	probably damaging	1.00
R2405:Kidins220	UTSW	12	25,061,508 (GRCm39)	missense	probably damaging	0.99
R3522:Kidins220	UTSW	12	25,040,757 (GRCm39)	missense	probably damaging	1.00
R3877:Kidins220	UTSW	12	25,051,564 (GRCm39)	splice site	probably benign
R3915:Kidins220	UTSW	12	25,103,957 (GRCm39)	missense	possibly damaging	0.93
R4023:Kidins220	UTSW	12	25,107,143 (GRCm39)	splice site	probably null
R4287:Kidins220	UTSW	12	25,106,845 (GRCm39)	missense	possibly damaging	0.81
R4476:Kidins220	UTSW	12	25,061,000 (GRCm39)	missense	probably damaging	1.00
R4495:Kidins220	UTSW	12	25,088,301 (GRCm39)	splice site	probably null
R4627:Kidins220	UTSW	12	25,107,041 (GRCm39)	missense	possibly damaging	0.89
R4807:Kidins220	UTSW	12	25,107,284 (GRCm39)	missense	probably damaging	1.00
R4899:Kidins220	UTSW	12	25,063,442 (GRCm39)	critical splice donor site	probably null
R4960:Kidins220	UTSW	12	25,042,259 (GRCm39)	nonsense	probably null
R5118:Kidins220	UTSW	12	25,042,296 (GRCm39)	missense	probably damaging	1.00
R5183:Kidins220	UTSW	12	25,101,125 (GRCm39)	missense	probably benign	0.17
R5238:Kidins220	UTSW	12	25,053,009 (GRCm39)	missense	probably benign	0.31
R5580:Kidins220	UTSW	12	25,097,896 (GRCm39)	missense	probably benign	0.00
R5707:Kidins220	UTSW	12	25,063,390 (GRCm39)	missense	probably damaging	1.00
R5813:Kidins220	UTSW	12	25,107,139 (GRCm39)	nonsense	probably null
R6131:Kidins220	UTSW	12	25,042,313 (GRCm39)	splice site	probably null
R6146:Kidins220	UTSW	12	25,102,812 (GRCm39)	missense	probably damaging	1.00
R6151:Kidins220	UTSW	12	25,106,908 (GRCm39)	missense	possibly damaging	0.65
R6160:Kidins220	UTSW	12	25,047,310 (GRCm39)	missense	probably damaging	1.00
R6187:Kidins220	UTSW	12	25,101,307 (GRCm39)	splice site	probably null
R6289:Kidins220	UTSW	12	25,106,615 (GRCm39)	missense	probably damaging	1.00
R6321:Kidins220	UTSW	12	25,107,533 (GRCm39)	missense	probably benign	0.09
R6450:Kidins220	UTSW	12	25,107,190 (GRCm39)	missense	probably benign
R6513:Kidins220	UTSW	12	25,088,434 (GRCm39)	missense	possibly damaging	0.94
R6711:Kidins220	UTSW	12	25,048,750 (GRCm39)	missense	probably damaging	0.96
R6858:Kidins220	UTSW	12	25,058,542 (GRCm39)	missense	possibly damaging	0.85
R7102:Kidins220	UTSW	12	25,107,662 (GRCm39)	missense	probably benign	0.00
R7112:Kidins220	UTSW	12	25,054,018 (GRCm39)	missense	probably damaging	1.00
R7139:Kidins220	UTSW	12	25,044,820 (GRCm39)	missense	probably damaging	1.00
R7140:Kidins220	UTSW	12	25,086,623 (GRCm39)	missense	probably damaging	1.00
R7271:Kidins220	UTSW	12	25,061,570 (GRCm39)	missense	probably benign	0.21
R7361:Kidins220	UTSW	12	25,106,999 (GRCm39)	missense	probably benign	0.01
R7509:Kidins220	UTSW	12	25,032,360 (GRCm39)	missense	probably damaging	0.98
R7510:Kidins220	UTSW	12	25,042,268 (GRCm39)	missense	possibly damaging	0.88
R7783:Kidins220	UTSW	12	25,038,555 (GRCm39)	missense	probably damaging	1.00
R7796:Kidins220	UTSW	12	25,032,350 (GRCm39)	missense	probably damaging	0.96
R7831:Kidins220	UTSW	12	25,111,230 (GRCm39)	missense	possibly damaging	0.90
R8074:Kidins220	UTSW	12	25,107,715 (GRCm39)	missense	probably benign	0.29
R8214:Kidins220	UTSW	12	25,044,854 (GRCm39)	missense	probably damaging	1.00
R8304:Kidins220	UTSW	12	25,107,127 (GRCm39)	missense	probably benign	0.01
R8313:Kidins220	UTSW	12	25,054,110 (GRCm39)	missense	probably damaging	1.00
R8346:Kidins220	UTSW	12	25,086,533 (GRCm39)	missense	probably damaging	1.00
R8392:Kidins220	UTSW	12	25,040,727 (GRCm39)	missense	probably damaging	1.00
R8482:Kidins220	UTSW	12	25,090,527 (GRCm39)	missense	probably benign	0.00
R8722:Kidins220	UTSW	12	25,051,593 (GRCm39)	missense	probably benign
R8831:Kidins220	UTSW	12	25,086,454 (GRCm39)	missense	possibly damaging	0.70
R8960:Kidins220	UTSW	12	25,106,914 (GRCm39)	missense	probably benign	0.05
R9193:Kidins220	UTSW	12	25,036,966 (GRCm39)	missense	possibly damaging	0.79
R9267:Kidins220	UTSW	12	25,038,558 (GRCm39)	missense	probably benign	0.29
R9303:Kidins220	UTSW	12	25,107,110 (GRCm39)	missense	probably benign	0.36
R9343:Kidins220	UTSW	12	25,058,078 (GRCm39)	missense	probably damaging	1.00
R9526:Kidins220	UTSW	12	25,088,383 (GRCm39)	missense	probably damaging	1.00
R9644:Kidins220	UTSW	12	25,061,018 (GRCm39)	missense	probably damaging	1.00
R9655:Kidins220	UTSW	12	25,047,295 (GRCm39)	missense	probably damaging	1.00
R9664:Kidins220	UTSW	12	25,106,895 (GRCm39)	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- AGTAAGTCTCTCAACCTCTTCTGTAG -3'
(R):5'- AAGTCATGCATCCCACGTGG -3'

Sequencing Primer
(F):5'- GTCTGTAAATTCCTATCATAGCATCC -3'
(R):5'- CACGTGGCCACAGTGACAAG -3'

Posted On

2018-07-24