Incidental Mutation 'R6652:Grap2'
ID528113
Institutional Source Beutler Lab
Gene Symbol Grap2
Ensembl Gene ENSMUSG00000042351
Gene NameGRB2-related adaptor protein 2
SynonymsMona, Grb2-related adaptor downstream of Sch, GRAP-2, GrbX, GRB2L, Grf40, GRID, P38, Gads, GrpL
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location80572594-80652854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80648522 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 297 (N297Y)
Ref Sequence ENSEMBL: ENSMUSP00000155681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043149] [ENSMUST00000229980] [ENSMUST00000230856]
Predicted Effect probably damaging
Transcript: ENSMUST00000043149
AA Change: N297Y

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046532
Gene: ENSMUSG00000042351
AA Change: N297Y

DomainStartEndE-ValueType
SH3 1 55 3.48e-16 SMART
SH2 56 138 7.49e-32 SMART
low complexity region 193 216 N/A INTRINSIC
SH3 266 321 4.31e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183708
Predicted Effect probably damaging
Transcript: ENSMUST00000229980
AA Change: N297Y

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000230856
Meta Mutation Damage Score 0.3713 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adaptor-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. Like its related family member, GRB2-related adaptor protein (GRAP), this protein contains an SH2 domain flanked by two SH3 domains. This protein interacts with other proteins, such as GRB2-associated binding protein 1 (GAB1) and the SLP-76 leukocyte protein (LCP2), through its SH3 domains. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene are grossly healthy but display abnormal T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Grap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Grap2 APN 15 80634409 missense probably damaging 1.00
IGL02121:Grap2 APN 15 80647875 missense possibly damaging 0.77
IGL02347:Grap2 APN 15 80646356 splice site probably benign
IGL02561:Grap2 APN 15 80647848 splice site probably benign
Aquavit UTSW 15 80643673 missense probably damaging 0.97
Grappa UTSW 15 80648522 missense probably damaging 0.98
R1465:Grap2 UTSW 15 80648411 splice site probably null
R1465:Grap2 UTSW 15 80648411 splice site probably null
R1591:Grap2 UTSW 15 80648448 missense probably damaging 1.00
R2050:Grap2 UTSW 15 80646243 missense probably benign 0.09
R2862:Grap2 UTSW 15 80647964 missense probably damaging 0.98
R3801:Grap2 UTSW 15 80623746 missense possibly damaging 0.62
R3804:Grap2 UTSW 15 80623746 missense possibly damaging 0.62
R4838:Grap2 UTSW 15 80638561 missense possibly damaging 0.92
R5090:Grap2 UTSW 15 80638482 missense possibly damaging 0.95
R5119:Grap2 UTSW 15 80646144 missense possibly damaging 0.93
R5121:Grap2 UTSW 15 80646144 missense possibly damaging 0.93
R6873:Grap2 UTSW 15 80643673 missense probably damaging 0.97
R7082:Grap2 UTSW 15 80648498 missense probably benign 0.27
R7512:Grap2 UTSW 15 80648553 missense probably benign 0.08
R7571:Grap2 UTSW 15 80643704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGATCTAGAAGCTCACGGC -3'
(R):5'- TTTGTGTACTCGGGCACACATG -3'

Sequencing Primer
(F):5'- CACGGCTCCTCTGTGTGATAG -3'
(R):5'- CTAAGCCTTGCAGTACGA -3'
Posted On2018-07-24