Incidental Mutation 'R6652:Zdhhc19'
ID528115
Institutional Source Beutler Lab
Gene Symbol Zdhhc19
Ensembl Gene ENSMUSG00000052363
Gene Namezinc finger, DHHC domain containing 19
SynonymsLOC245308
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location32496265-32561966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32497229 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 48 (F48S)
Ref Sequence ENSEMBL: ENSMUSP00000070727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064192] [ENSMUST00000231510]
Predicted Effect probably damaging
Transcript: ENSMUST00000064192
AA Change: F48S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070727
Gene: ENSMUSG00000052363
AA Change: F48S

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Pfam:zf-DHHC 107 230 2.5e-32 PFAM
low complexity region 291 306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231293
Predicted Effect probably benign
Transcript: ENSMUST00000231510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232434
Meta Mutation Damage Score 0.5194 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Zdhhc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02513:Zdhhc19 APN 16 32499622 missense probably damaging 0.96
IGL02852:Zdhhc19 APN 16 32497642 missense probably damaging 1.00
R1163:Zdhhc19 UTSW 16 32506440 missense probably benign 0.09
R1903:Zdhhc19 UTSW 16 32498413 nonsense probably null
R4617:Zdhhc19 UTSW 16 32497676 missense probably damaging 1.00
R4771:Zdhhc19 UTSW 16 32499135 missense probably damaging 1.00
R5405:Zdhhc19 UTSW 16 32507051 missense possibly damaging 0.65
R6030:Zdhhc19 UTSW 16 32499042 missense probably null 1.00
R6030:Zdhhc19 UTSW 16 32499042 missense probably null 1.00
R6802:Zdhhc19 UTSW 16 32506358 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTTGCCCACTGAGCTGTGTAC -3'
(R):5'- TCTAAGTATCCAGGCAAGGGAC -3'

Sequencing Primer
(F):5'- GAGCTGTGTACTCTGCCCTG -3'
(R):5'- TATCCAGGCAAGGGACAGACTC -3'
Posted On2018-07-24