Incidental Mutation 'R6652:Cwf19l1'
ID528117
Institutional Source Beutler Lab
Gene Symbol Cwf19l1
Ensembl Gene ENSMUSG00000025200
Gene NameCWF19-like 1, cell cycle control (S. pombe)
Synonyms2610528C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location44108644-44135876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44114699 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 359 (D359G)
Ref Sequence ENSEMBL: ENSMUSP00000026218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026218]
Predicted Effect probably benign
Transcript: ENSMUST00000026218
AA Change: D359G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026218
Gene: ENSMUSG00000025200
AA Change: D359G

DomainStartEndE-ValueType
Pfam:CwfJ_C_1 314 433 5.6e-37 PFAM
Pfam:CwfJ_C_2 439 534 2.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104203
Meta Mutation Damage Score 0.0927 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CWF19 protein family. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia-17 and mild mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Cwf19l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Cwf19l1 APN 19 44131410 critical splice donor site probably null
IGL01691:Cwf19l1 APN 19 44120872 critical splice donor site probably null
IGL02427:Cwf19l1 APN 19 44133023 nonsense probably null
IGL03234:Cwf19l1 APN 19 44127370 missense probably damaging 1.00
IGL03236:Cwf19l1 APN 19 44127448 missense probably benign 0.00
IGL03275:Cwf19l1 APN 19 44123257 missense probably benign 0.10
R0068:Cwf19l1 UTSW 19 44131499 missense probably damaging 0.99
R0068:Cwf19l1 UTSW 19 44131499 missense probably damaging 0.99
R0486:Cwf19l1 UTSW 19 44114690 missense probably benign 0.35
R1820:Cwf19l1 UTSW 19 44127387 missense probably benign 0.00
R2317:Cwf19l1 UTSW 19 44132158 missense possibly damaging 0.92
R2418:Cwf19l1 UTSW 19 44131472 missense probably benign
R2438:Cwf19l1 UTSW 19 44110563 missense probably benign 0.00
R3796:Cwf19l1 UTSW 19 44114567 missense probably damaging 0.97
R3850:Cwf19l1 UTSW 19 44131498 missense probably benign 0.24
R4518:Cwf19l1 UTSW 19 44133034 missense probably damaging 1.00
R4855:Cwf19l1 UTSW 19 44114567 missense probably damaging 0.97
R5402:Cwf19l1 UTSW 19 44133085 critical splice acceptor site probably null
R5587:Cwf19l1 UTSW 19 44120877 missense possibly damaging 0.49
R5785:Cwf19l1 UTSW 19 44121941 missense probably damaging 0.98
R6354:Cwf19l1 UTSW 19 44127473 missense probably benign 0.10
R7365:Cwf19l1 UTSW 19 44132140 missense probably damaging 1.00
R7548:Cwf19l1 UTSW 19 44110550 missense probably benign 0.18
R7562:Cwf19l1 UTSW 19 44129241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGGTGATGGCTCCTAT -3'
(R):5'- GGATTCCGTGAAACTGGCATT -3'

Sequencing Primer
(F):5'- AGGTGATGGCTCCTATAATTTCTTTC -3'
(R):5'- GAATTTGAGGCTGCCCTGTACAAC -3'
Posted On2018-07-24