Incidental Mutation 'R6652:Sfxn3'
ID528118
Institutional Source Beutler Lab
Gene Symbol Sfxn3
Ensembl Gene ENSMUSG00000025212
Gene Namesideroflexin 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location45047576-45056383 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 45049915 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062213] [ENSMUST00000062213] [ENSMUST00000084493] [ENSMUST00000084493] [ENSMUST00000111954] [ENSMUST00000111954] [ENSMUST00000145391] [ENSMUST00000169459]
Predicted Effect probably null
Transcript: ENSMUST00000062213
SMART Domains Protein: ENSMUSP00000059419
Gene: ENSMUSG00000025212

DomainStartEndE-ValueType
Pfam:Mtc 15 321 1.8e-154 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000062213
SMART Domains Protein: ENSMUSP00000059419
Gene: ENSMUSG00000025212

DomainStartEndE-ValueType
Pfam:Mtc 15 321 1.8e-154 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084493
SMART Domains Protein: ENSMUSP00000081537
Gene: ENSMUSG00000025212

DomainStartEndE-ValueType
Pfam:Mtc 15 230 2.5e-106 PFAM
Pfam:Mtc 225 280 2.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084493
SMART Domains Protein: ENSMUSP00000081537
Gene: ENSMUSG00000025212

DomainStartEndE-ValueType
Pfam:Mtc 15 230 2.5e-106 PFAM
Pfam:Mtc 225 280 2.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111954
SMART Domains Protein: ENSMUSP00000107585
Gene: ENSMUSG00000025212

DomainStartEndE-ValueType
Pfam:Mtc 15 114 1.4e-48 PFAM
Pfam:Mtc 110 288 2.3e-78 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111954
SMART Domains Protein: ENSMUSP00000107585
Gene: ENSMUSG00000025212

DomainStartEndE-ValueType
Pfam:Mtc 15 114 1.4e-48 PFAM
Pfam:Mtc 110 288 2.3e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145391
SMART Domains Protein: ENSMUSP00000119002
Gene: ENSMUSG00000074818

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169459
SMART Domains Protein: ENSMUSP00000133273
Gene: ENSMUSG00000074818

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Meta Mutation Damage Score 0.9508 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal mitochondrial bioenergetics in isolated synaptosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Sfxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
basilica UTSW 19 45049915 critical splice donor site probably null
pew UTSW 19 45049815 missense probably damaging 1.00
R4652:Sfxn3 UTSW 19 45050874 critical splice acceptor site probably null
R4889:Sfxn3 UTSW 19 45049815 missense probably damaging 1.00
R6649:Sfxn3 UTSW 19 45049915 critical splice donor site probably null
R6650:Sfxn3 UTSW 19 45049915 critical splice donor site probably null
R6651:Sfxn3 UTSW 19 45049915 critical splice donor site probably null
R6653:Sfxn3 UTSW 19 45049915 critical splice donor site probably null
R7341:Sfxn3 UTSW 19 45049262 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCAATTTCTACAGGGCTGG -3'
(R):5'- AAGTGAGACTTAGCTCATGGTCC -3'

Sequencing Primer
(F):5'- TACAGGGCTGGTGTGGCAAC -3'
(R):5'- TAGCTCATGGTCCCCAAACTGG -3'
Posted On2018-07-24