Incidental Mutation 'R6652:Stn1'
ID528119
Institutional Source Beutler Lab
Gene Symbol Stn1
Ensembl Gene ENSMUSG00000042694
Gene NameSTN1, CST complex subunit
Synonyms0610009H20Rik, 2310057J23Rik, Obfc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location47501033-47537507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47507578 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 334 (T334A)
Ref Sequence ENSEMBL: ENSMUSP00000138727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049369] [ENSMUST00000182808]
Predicted Effect probably benign
Transcript: ENSMUST00000049369
SMART Domains Protein: ENSMUSP00000040944
Gene: ENSMUSG00000042694

DomainStartEndE-ValueType
Pfam:Stn1 31 110 1.4e-8 PFAM
Pfam:tRNA_anti-codon 64 165 3e-8 PFAM
Pfam:STN1_2 167 344 7.9e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182808
AA Change: T334A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138727
Gene: ENSMUSG00000042694
AA Change: T334A

DomainStartEndE-ValueType
Pfam:Stn1 31 110 1.8e-5 PFAM
Pfam:tRNA_anti-codon 64 165 4.1e-7 PFAM
Pfam:STN1_2 167 330 2.7e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182873
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] OBFC1 and C17ORF68 (MIM 613129) are subunits of an alpha accessory factor (AAF) that stimulates the activity of DNA polymerase-alpha-primase (see MIM 176636), the enzyme that initiates DNA replication (Casteel et al., 2009 [PubMed 19119139]). OBFC1 also appears to function in a telomere-associated complex with C17ORF68 and TEN1 (C17ORF106; MIM 613130) (Miyake et al., 2009 [PubMed 19854130]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Stn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Stn1 APN 19 47516173 missense possibly damaging 0.71
IGL02338:Stn1 APN 19 47513890 missense probably damaging 1.00
R0309:Stn1 UTSW 19 47501673 missense probably benign 0.01
R1552:Stn1 UTSW 19 47536373 critical splice acceptor site probably null
R3907:Stn1 UTSW 19 47507823 missense probably damaging 1.00
R5866:Stn1 UTSW 19 47517129 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGCCTGAAACTGAAAAGCCTTG -3'
(R):5'- ACCAAACCGTAAGTGTTTTGTG -3'

Sequencing Primer
(F):5'- CTGAAAAGCCTTGATGTTTGAGAAG -3'
(R):5'- TCCTAGACAGAATCAGGATGCTCTG -3'
Posted On2018-07-24