Incidental Mutation 'R6693:Glb1l'
ID528156
Institutional Source Beutler Lab
Gene Symbol Glb1l
Ensembl Gene ENSMUSG00000026200
Gene Namegalactosidase, beta 1-like
Synonyms4833408P15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75198236-75210813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75209101 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 61 (D61G)
Ref Sequence ENSEMBL: ENSMUSP00000140820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027401] [ENSMUST00000113623] [ENSMUST00000123825] [ENSMUST00000144355] [ENSMUST00000155716] [ENSMUST00000185448] [ENSMUST00000189698] [ENSMUST00000188460] [ENSMUST00000191108]
Predicted Effect probably benign
Transcript: ENSMUST00000027401
SMART Domains Protein: ENSMUSP00000027401
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 290 3.3e-47 PFAM
Pfam:Pkinase_Tyr 21 290 3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113623
AA Change: D61G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109253
Gene: ENSMUSG00000026200
AA Change: D61G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.1e-123 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123825
SMART Domains Protein: ENSMUSP00000122688
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142052
Predicted Effect probably benign
Transcript: ENSMUST00000144355
SMART Domains Protein: ENSMUSP00000115964
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145144
Predicted Effect probably damaging
Transcript: ENSMUST00000155716
AA Change: D61G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136285
Gene: ENSMUSG00000026200
AA Change: D61G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.2e-125 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184844
Predicted Effect probably damaging
Transcript: ENSMUST00000185448
AA Change: D61G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140820
Gene: ENSMUSG00000026200
AA Change: D61G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 188 1.6e-71 PFAM
Pfam:Glyco_hydro_42 48 188 6.4e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186173
AA Change: D55G
Predicted Effect probably benign
Transcript: ENSMUST00000189698
SMART Domains Protein: ENSMUSP00000140329
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 203 1.1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188460
SMART Domains Protein: ENSMUSP00000139998
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 172 1e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186350
Predicted Effect probably benign
Transcript: ENSMUST00000191108
SMART Domains Protein: ENSMUSP00000139846
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 186 8.6e-29 PFAM
Pfam:Pkinase_Tyr 21 184 2.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186492
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Glb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Glb1l APN 1 75201238 missense probably damaging 0.99
IGL01477:Glb1l APN 1 75208706 missense probably damaging 1.00
R0408:Glb1l UTSW 1 75208835 missense probably damaging 1.00
R0620:Glb1l UTSW 1 75199720 missense probably damaging 1.00
R1639:Glb1l UTSW 1 75199601 missense probably benign 0.16
R1842:Glb1l UTSW 1 75200460 missense probably damaging 0.96
R2508:Glb1l UTSW 1 75201829 missense probably damaging 0.99
R2920:Glb1l UTSW 1 75209190 missense probably benign
R3439:Glb1l UTSW 1 75202620 missense probably damaging 1.00
R4096:Glb1l UTSW 1 75209440 start codon destroyed probably benign 0.01
R4517:Glb1l UTSW 1 75208703 missense probably damaging 1.00
R4829:Glb1l UTSW 1 75200350 missense probably damaging 0.96
R4851:Glb1l UTSW 1 75208884 unclassified probably benign
R4859:Glb1l UTSW 1 75200319 splice site probably benign
R4951:Glb1l UTSW 1 75208375 missense probably damaging 1.00
R6163:Glb1l UTSW 1 75201407 missense probably benign
R6519:Glb1l UTSW 1 75201056 missense probably benign 0.41
R6713:Glb1l UTSW 1 75202417 missense probably benign 0.02
R6833:Glb1l UTSW 1 75201753 missense possibly damaging 0.93
R6834:Glb1l UTSW 1 75201753 missense possibly damaging 0.93
R7068:Glb1l UTSW 1 75202737 missense probably damaging 1.00
R7453:Glb1l UTSW 1 75202706 missense probably damaging 1.00
R7694:Glb1l UTSW 1 75201792 missense probably damaging 1.00
R8784:Glb1l UTSW 1 75200331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGGAGACTCAGAACTTGC -3'
(R):5'- ACACTGATCCTTACTCCGGAC -3'

Sequencing Primer
(F):5'- CTAGAAAGAGGTTCTGAGCCATTC -3'
(R):5'- TACTCCGGACCTCTGCTGAG -3'
Posted On2018-07-24