Incidental Mutation 'R6693:Scg2'
ID528157
Institutional Source Beutler Lab
Gene Symbol Scg2
Ensembl Gene ENSMUSG00000050711
Gene Namesecretogranin II
SynonymsSgII, Chgc
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location79434669-79440120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 79436020 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 329 (Q329K)
Ref Sequence ENSEMBL: ENSMUSP00000062556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049972] [ENSMUST00000185234]
Predicted Effect probably benign
Transcript: ENSMUST00000049972
AA Change: Q329K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000062556
Gene: ENSMUSG00000050711
AA Change: Q329K

DomainStartEndE-ValueType
Pfam:Granin 27 614 7.2e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185234
SMART Domains Protein: ENSMUSP00000139740
Gene: ENSMUSG00000050711

DomainStartEndE-ValueType
Pfam:Granin 27 319 1.4e-123 PFAM
Pfam:Granin 316 574 7.1e-91 PFAM
Meta Mutation Damage Score 0.2381 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Scg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Scg2 APN 1 79436821 missense probably benign 0.16
IGL02083:Scg2 APN 1 79436224 missense probably benign 0.00
IGL02316:Scg2 APN 1 79435681 missense probably damaging 1.00
IGL02338:Scg2 APN 1 79436493 missense possibly damaging 0.93
R0281:Scg2 UTSW 1 79435512 missense possibly damaging 0.95
R0384:Scg2 UTSW 1 79435549 missense probably benign 0.42
R0501:Scg2 UTSW 1 79435603 missense probably damaging 1.00
R0909:Scg2 UTSW 1 79435782 missense possibly damaging 0.74
R1773:Scg2 UTSW 1 79435635 missense probably benign 0.04
R2254:Scg2 UTSW 1 79436500 missense probably damaging 1.00
R4074:Scg2 UTSW 1 79436857 missense probably damaging 0.97
R4076:Scg2 UTSW 1 79436857 missense probably damaging 0.97
R4097:Scg2 UTSW 1 79435821 missense probably damaging 0.99
R4560:Scg2 UTSW 1 79435181 missense probably damaging 1.00
R4621:Scg2 UTSW 1 79436664 missense probably benign 0.08
R4876:Scg2 UTSW 1 79435919 missense probably damaging 1.00
R4944:Scg2 UTSW 1 79436476 nonsense probably null
R5829:Scg2 UTSW 1 79436920 missense probably damaging 1.00
R6158:Scg2 UTSW 1 79435400 missense probably damaging 1.00
R6248:Scg2 UTSW 1 79436306 missense probably benign 0.29
R6365:Scg2 UTSW 1 79435300 missense probably benign
R6459:Scg2 UTSW 1 79436290 missense probably damaging 1.00
R6676:Scg2 UTSW 1 79435782 missense possibly damaging 0.74
R7259:Scg2 UTSW 1 79436985 missense probably benign
R7393:Scg2 UTSW 1 79435231 missense probably damaging 1.00
R7578:Scg2 UTSW 1 79436895 missense probably damaging 0.99
R7608:Scg2 UTSW 1 79436181 missense probably benign 0.00
R8166:Scg2 UTSW 1 79435583 missense possibly damaging 0.56
R8247:Scg2 UTSW 1 79436519 missense possibly damaging 0.92
R8296:Scg2 UTSW 1 79435505 missense probably benign 0.13
R8308:Scg2 UTSW 1 79436859 missense probably benign 0.18
R8789:Scg2 UTSW 1 79435783 missense probably benign 0.05
Z1176:Scg2 UTSW 1 79436789 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGTCATCTAGGTCAACAGCAAG -3'
(R):5'- CTCAAACCCAGGAAGAGGTG -3'

Sequencing Primer
(F):5'- AAGCTCCAGATCCTGCTCTG -3'
(R):5'- CCCAGGAAGAGGTGAGAGAC -3'
Posted On2018-07-24