Incidental Mutation 'R6693:Tmem8b'
ID528162
Institutional Source Beutler Lab
Gene Symbol Tmem8b
Ensembl Gene ENSMUSG00000078716
Gene Nametransmembrane protein 8B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43668971-43692668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43669837 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 111 (E111G)
Ref Sequence ENSEMBL: ENSMUSP00000103498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056474] [ENSMUST00000107864] [ENSMUST00000107865] [ENSMUST00000107866] [ENSMUST00000143339] [ENSMUST00000167153]
Predicted Effect probably benign
Transcript: ENSMUST00000056474
SMART Domains Protein: ENSMUSP00000057398
Gene: ENSMUSG00000043633

DomainStartEndE-ValueType
low complexity region 81 105 N/A INTRINSIC
internal_repeat_1 119 164 1.12e-19 PROSPERO
internal_repeat_1 165 210 1.12e-19 PROSPERO
low complexity region 267 285 N/A INTRINSIC
Pfam:DUF4475 312 482 1.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107864
SMART Domains Protein: ENSMUSP00000103496
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107865
SMART Domains Protein: ENSMUSP00000103497
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107866
AA Change: E111G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103498
Gene: ENSMUSG00000078716
AA Change: E111G

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 45 71 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
EGF 606 642 1.95e1 SMART
Pfam:DUF3522 652 836 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141864
Predicted Effect probably benign
Transcript: ENSMUST00000143339
SMART Domains Protein: ENSMUSP00000130133
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143774
Predicted Effect probably benign
Transcript: ENSMUST00000167153
SMART Domains Protein: ENSMUSP00000129760
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Tmem8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Tmem8b APN 4 43689434 missense probably benign 0.15
IGL02677:Tmem8b APN 4 43686092 missense probably damaging 1.00
IGL03090:Tmem8b APN 4 43689721 missense probably damaging 0.99
IGL03379:Tmem8b APN 4 43685561 missense probably benign 0.42
R0321:Tmem8b UTSW 4 43674444 missense probably damaging 1.00
R0377:Tmem8b UTSW 4 43674005 missense probably damaging 1.00
R0456:Tmem8b UTSW 4 43685618 missense probably benign 0.04
R0629:Tmem8b UTSW 4 43669896 splice site probably null
R0646:Tmem8b UTSW 4 43690123 missense probably benign 0.01
R0690:Tmem8b UTSW 4 43674562 missense possibly damaging 0.69
R1484:Tmem8b UTSW 4 43690234 missense probably benign 0.01
R1558:Tmem8b UTSW 4 43681134 missense possibly damaging 0.95
R1733:Tmem8b UTSW 4 43690228 splice site probably null
R1999:Tmem8b UTSW 4 43681300 missense probably damaging 0.99
R2414:Tmem8b UTSW 4 43673892 splice site probably benign
R3799:Tmem8b UTSW 4 43673892 splice site probably benign
R3820:Tmem8b UTSW 4 43689745 missense probably damaging 0.99
R3821:Tmem8b UTSW 4 43689745 missense probably damaging 0.99
R4581:Tmem8b UTSW 4 43685760 missense probably damaging 1.00
R4852:Tmem8b UTSW 4 43689713 missense probably damaging 0.99
R5214:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5311:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5448:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5449:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5450:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R6245:Tmem8b UTSW 4 43690246 missense probably benign 0.14
R6615:Tmem8b UTSW 4 43682249 missense probably damaging 1.00
R6944:Tmem8b UTSW 4 43674465 missense probably damaging 1.00
R6994:Tmem8b UTSW 4 43690192 missense probably damaging 0.96
R7136:Tmem8b UTSW 4 43669845 missense possibly damaging 0.83
R7704:Tmem8b UTSW 4 43689461 missense probably damaging 0.96
R8048:Tmem8b UTSW 4 43689476 missense possibly damaging 0.92
R8064:Tmem8b UTSW 4 43690139 missense probably damaging 1.00
Z1176:Tmem8b UTSW 4 43689710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTTCAGCCTTGGCCTCCG -3'
(R):5'- AAGCTATCCCTCCCTGGAAC -3'

Sequencing Primer
(F):5'- TGTCCCAGCGAATGTCCAG -3'
(R):5'- TGGAACCCCATCCGGTCTC -3'
Posted On2018-07-24