Incidental Mutation 'R6693:Adamtsl1'
ID528163
Institutional Source Beutler Lab
Gene Symbol Adamtsl1
Ensembl Gene ENSMUSG00000066113
Gene NameADAMTS-like 1
Synonyms5930437A14Rik, 6720426B09Rik, punctin-1
MMRRC Submission
Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R6693 (G1)
Quality Score206.009
Status Validated
Chromosome4
Chromosomal Location85514172-86428385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86342886 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1111 (H1111Q)
Ref Sequence ENSEMBL: ENSMUSP00000119278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107177
Predicted Effect probably benign
Transcript: ENSMUST00000107178
AA Change: H1119Q

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: H1119Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 362 421 2.05e-2 SMART
TSP1 422 476 3.99e-4 SMART
TSP1 508 567 6.39e-3 SMART
TSP1 593 650 7.86e-3 SMART
TSP1 652 712 3.78e-5 SMART
TSP1 715 772 2.66e-2 SMART
TSP1 774 833 1.62e-4 SMART
IGc2 873 937 4.19e-6 SMART
low complexity region 1123 1142 N/A INTRINSIC
IGc2 1175 1240 1.31e-7 SMART
IGc2 1282 1351 7.81e-15 SMART
IGc2 1400 1467 2.39e-10 SMART
TSP1 1481 1537 2.12e-1 SMART
TSP1 1540 1599 1.74e-4 SMART
TSP1 1600 1658 8.2e0 SMART
TSP1 1660 1717 1.96e-1 SMART
Pfam:PLAC 1721 1751 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141889
AA Change: H1111Q

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: H1111Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 379 438 2.05e-2 SMART
TSP1 439 493 3.99e-4 SMART
TSP1 525 584 6.39e-3 SMART
TSP1 610 667 7.86e-3 SMART
TSP1 707 764 2.66e-2 SMART
TSP1 766 825 1.62e-4 SMART
IGc2 865 929 4.19e-6 SMART
low complexity region 1115 1134 N/A INTRINSIC
IGc2 1167 1232 1.31e-7 SMART
IGc2 1274 1343 7.81e-15 SMART
IGc2 1392 1459 2.39e-10 SMART
TSP1 1473 1529 2.12e-1 SMART
TSP1 1532 1591 1.74e-4 SMART
TSP1 1592 1650 8.2e0 SMART
TSP1 1652 1709 1.96e-1 SMART
Pfam:PLAC 1712 1744 5.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Adamtsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Adamtsl1 APN 4 86385640 missense probably benign 0.01
IGL00741:Adamtsl1 APN 4 86276948 missense probably damaging 1.00
IGL00770:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00774:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00826:Adamtsl1 APN 4 86156804 missense probably damaging 1.00
IGL00938:Adamtsl1 APN 4 86342278 missense possibly damaging 0.93
IGL01012:Adamtsl1 APN 4 86342189 missense possibly damaging 0.93
IGL01728:Adamtsl1 APN 4 86110837 missense probably damaging 1.00
IGL01801:Adamtsl1 APN 4 86199322 missense probably benign 0.23
IGL01922:Adamtsl1 APN 4 86249902 missense probably damaging 1.00
IGL02006:Adamtsl1 APN 4 86199345 missense probably damaging 1.00
IGL02192:Adamtsl1 APN 4 86228016 missense probably damaging 1.00
IGL02351:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02358:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02373:Adamtsl1 APN 4 86249805 missense probably damaging 1.00
IGL02660:Adamtsl1 APN 4 86232610 missense probably damaging 1.00
IGL02964:Adamtsl1 APN 4 86424357 missense probably damaging 1.00
IGL03233:Adamtsl1 APN 4 86342120 missense probably damaging 1.00
IGL03297:Adamtsl1 APN 4 86423426 missense probably damaging 0.98
IGL03326:Adamtsl1 APN 4 86252748 splice site probably benign
PIT4378001:Adamtsl1 UTSW 4 86199364 missense possibly damaging 0.93
PIT4418001:Adamtsl1 UTSW 4 86243724 missense probably damaging 1.00
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0132:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0453:Adamtsl1 UTSW 4 86232615 missense probably damaging 1.00
R0480:Adamtsl1 UTSW 4 86252818 missense probably benign 0.08
R0496:Adamtsl1 UTSW 4 86341198 missense probably damaging 1.00
R0538:Adamtsl1 UTSW 4 86343121 missense probably benign 0.27
R0547:Adamtsl1 UTSW 4 86356355 missense probably benign 0.37
R0567:Adamtsl1 UTSW 4 86228016 missense probably damaging 1.00
R0568:Adamtsl1 UTSW 4 86418552 missense probably damaging 1.00
R0639:Adamtsl1 UTSW 4 86277143 missense probably damaging 1.00
R0931:Adamtsl1 UTSW 4 86249847 missense probably benign 0.05
R1186:Adamtsl1 UTSW 4 86388509 missense probably benign 0.00
R1387:Adamtsl1 UTSW 4 86374993 splice site probably benign
R1459:Adamtsl1 UTSW 4 86425865 missense probably damaging 1.00
R1518:Adamtsl1 UTSW 4 86342603 missense probably damaging 0.99
R1532:Adamtsl1 UTSW 4 86248065 missense probably benign 0.02
R1603:Adamtsl1 UTSW 4 86415530 missense probably benign
R1931:Adamtsl1 UTSW 4 86342411 missense possibly damaging 0.62
R2086:Adamtsl1 UTSW 4 86228012 missense probably damaging 1.00
R2221:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2223:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2396:Adamtsl1 UTSW 4 86343119 nonsense probably null
R2397:Adamtsl1 UTSW 4 86199357 missense probably damaging 1.00
R2426:Adamtsl1 UTSW 4 86156788 missense probably benign 0.01
R3121:Adamtsl1 UTSW 4 86337009 missense probably damaging 1.00
R3715:Adamtsl1 UTSW 4 86216976 missense probably benign 0.01
R3848:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3849:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3850:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R4194:Adamtsl1 UTSW 4 86054008 intron probably benign
R4354:Adamtsl1 UTSW 4 86156684 missense probably damaging 1.00
R4795:Adamtsl1 UTSW 4 86243769 critical splice donor site probably null
R4830:Adamtsl1 UTSW 4 86356382 missense probably damaging 0.97
R4874:Adamtsl1 UTSW 4 86342492 missense possibly damaging 0.94
R4939:Adamtsl1 UTSW 4 86243725 missense possibly damaging 0.95
R4942:Adamtsl1 UTSW 4 86341214 nonsense probably null
R4947:Adamtsl1 UTSW 4 85764800 missense possibly damaging 0.93
R4960:Adamtsl1 UTSW 4 86424173 nonsense probably null
R4971:Adamtsl1 UTSW 4 86336931 missense probably damaging 1.00
R5141:Adamtsl1 UTSW 4 86156850 missense possibly damaging 0.77
R5213:Adamtsl1 UTSW 4 86385628 missense possibly damaging 0.89
R5237:Adamtsl1 UTSW 4 86385669 critical splice donor site probably null
R5250:Adamtsl1 UTSW 4 86216945 nonsense probably null
R5411:Adamtsl1 UTSW 4 86388413 critical splice acceptor site probably null
R5554:Adamtsl1 UTSW 4 86276945 missense possibly damaging 0.69
R5631:Adamtsl1 UTSW 4 86276923 nonsense probably null
R5739:Adamtsl1 UTSW 4 86232664 missense probably damaging 1.00
R5905:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6028:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6044:Adamtsl1 UTSW 4 86212691 missense probably damaging 1.00
R6261:Adamtsl1 UTSW 4 86336878 missense probably benign 0.09
R6300:Adamtsl1 UTSW 4 86248017 missense probably damaging 1.00
R6332:Adamtsl1 UTSW 4 86217011 missense probably damaging 0.96
R6560:Adamtsl1 UTSW 4 86336893 missense probably damaging 1.00
R6736:Adamtsl1 UTSW 4 86342247 missense probably damaging 1.00
R6964:Adamtsl1 UTSW 4 86156854 missense probably damaging 1.00
R7064:Adamtsl1 UTSW 4 86342041 missense possibly damaging 0.80
R7434:Adamtsl1 UTSW 4 86425878 missense probably damaging 0.99
R7477:Adamtsl1 UTSW 4 86415651 missense probably damaging 1.00
R7545:Adamtsl1 UTSW 4 85764855 missense probably damaging 1.00
R7556:Adamtsl1 UTSW 4 86277121 missense probably benign 0.19
R7580:Adamtsl1 UTSW 4 86054064 missense possibly damaging 0.53
R7593:Adamtsl1 UTSW 4 86341213 missense probably damaging 1.00
R7710:Adamtsl1 UTSW 4 86232573 missense
Predicted Primers PCR Primer
(F):5'- GGATGACATCCTCAGGAACC -3'
(R):5'- GAATTGAACTGCTTCTCCGTTC -3'

Sequencing Primer
(F):5'- GAACCTGTCCCAGCAGC -3'
(R):5'- GCAGAAGCACACTCAGGGTC -3'
Posted On2018-07-24