Incidental Mutation 'R6693:Olfr146'
List |< first << previous [record 22 of 36] next >> last >|
ID528173
Institutional Source Beutler Lab
Gene Symbol Olfr146
Ensembl Gene ENSMUSG00000058820
Gene Nameolfactory receptor 146
SynonymsGA_x6K02T2PVTD-32715386-32714466, MOR171-10, M15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39018073-39023377 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39018801 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 247 (A247T)
Ref Sequence ENSEMBL: ENSMUSP00000149294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073671] [ENSMUST00000214369] [ENSMUST00000214410] [ENSMUST00000215383]
Predicted Effect probably damaging
Transcript: ENSMUST00000073671
AA Change: A247T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073352
Gene: ENSMUSG00000058820
AA Change: A247T

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.6e-54 PFAM
Pfam:7tm_1 41 290 8.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214369
Predicted Effect probably damaging
Transcript: ENSMUST00000214410
AA Change: A247T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000215383
Meta Mutation Damage Score 0.3907 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Olfr146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Olfr146 APN 9 39018801 missense probably damaging 0.98
IGL01655:Olfr146 APN 9 39018918 missense probably benign 0.00
IGL01804:Olfr146 APN 9 39019401 missense probably benign 0.13
IGL02098:Olfr146 APN 9 39018891 missense probably damaging 1.00
IGL02719:Olfr146 APN 9 39019016 missense probably benign 0.11
R0531:Olfr146 UTSW 9 39019176 missense probably damaging 0.97
R1270:Olfr146 UTSW 9 39019247 missense possibly damaging 0.90
R1511:Olfr146 UTSW 9 39019025 missense probably benign 0.03
R1590:Olfr146 UTSW 9 39018957 missense probably benign 0.09
R1649:Olfr146 UTSW 9 39019480 missense probably benign 0.03
R3419:Olfr146 UTSW 9 39019076 missense probably benign 0.03
R4669:Olfr146 UTSW 9 39019379 missense probably benign 0.10
R4788:Olfr146 UTSW 9 39018921 missense probably benign 0.07
R5184:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R5581:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6319:Olfr146 UTSW 9 39019514 missense probably damaging 1.00
R6626:Olfr146 UTSW 9 39019106 missense possibly damaging 0.63
R7165:Olfr146 UTSW 9 39023270 start gained probably benign
R7947:Olfr146 UTSW 9 39019451 missense probably damaging 0.99
R7957:Olfr146 UTSW 9 39019053 missense probably benign
R8052:Olfr146 UTSW 9 39019487 missense probably damaging 0.99
R8162:Olfr146 UTSW 9 39018953 missense probably benign 0.01
Z1088:Olfr146 UTSW 9 39018789 missense probably damaging 1.00
Z1191:Olfr146 UTSW 9 39018933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCAGAGCAATTTTCACGTC -3'
(R):5'- GTGCATCAGCTCATGTAGGATG -3'

Sequencing Primer
(F):5'- CGTCCTTATTCCTAAGACTGTAAATC -3'
(R):5'- TGATCAACCATTATTTCTGTGACC -3'
Posted On2018-07-24