Incidental Mutation 'R6693:Myo6'
ID528175
Institutional Source Beutler Lab
Gene Symbol Myo6
Ensembl Gene ENSMUSG00000033577
Gene Namemyosin VI
SynonymsTlc
MMRRC Submission
Accession Numbers

MGI:104785

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location80165031-80311729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80245731 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 215 (N215K)
Ref Sequence ENSEMBL: ENSMUSP00000108891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035889] [ENSMUST00000076140] [ENSMUST00000113266] [ENSMUST00000113268] [ENSMUST00000127779] [ENSMUST00000184480]
Predicted Effect probably damaging
Transcript: ENSMUST00000035889
AA Change: N215K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036181
Gene: ENSMUSG00000033577
AA Change: N215K

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1134 1262 1e-74 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000076140
AA Change: N215K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075501
Gene: ENSMUSG00000033577
AA Change: N215K

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1126 2e-27 BLAST
PDB:3H8D|D 1138 1266 8e-75 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000113266
AA Change: N215K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108891
Gene: ENSMUSG00000033577
AA Change: N215K

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1125 1253 9e-75 PDB
Predicted Effect unknown
Transcript: ENSMUST00000113268
AA Change: N215K
SMART Domains Protein: ENSMUSP00000108893
Gene: ENSMUSG00000033577
AA Change: N215K

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1135 2e-26 BLAST
Pfam:Myosin-VI_CBD 1167 1257 1.4e-46 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127779
AA Change: N215K
SMART Domains Protein: ENSMUSP00000139228
Gene: ENSMUSG00000033577
AA Change: N215K

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1136 1e-26 BLAST
PDB:3H8D|D 1157 1285 9e-75 PDB
Predicted Effect unknown
Transcript: ENSMUST00000184480
AA Change: N215K
SMART Domains Protein: ENSMUSP00000139019
Gene: ENSMUSG00000033577
AA Change: N215K

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1145 1e-25 BLAST
PDB:3H8D|D 1166 1294 8e-75 PDB
Meta Mutation Damage Score 0.3337 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a reverse-direction motor protein that moves toward the minus end of actin filaments and plays a role in intracellular vesicle and organelle transport. The protein consists of a motor domain containing an ATP- and an actin-binding site and a globular tail which interacts with other proteins. This protein maintains the structural integrity of inner ear hair cells and mutations in this gene cause non-syndromic autosomal dominant and recessive hearing loss. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous mutant mice exhibit deafness and related behavioral characteristics such as circling, head tossing and hyperactivity. Progressive degeneration of the cochlear hair cells and the organ of Corti is observed with one mutation. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(6) Spontaneous(3) Chemically induced(2)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Myo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Myo6 APN 9 80292472 missense probably damaging 0.98
IGL00584:Myo6 APN 9 80242273 splice site probably benign
IGL00596:Myo6 APN 9 80281743 missense possibly damaging 0.91
IGL00778:Myo6 APN 9 80283586 critical splice donor site probably null
IGL01667:Myo6 APN 9 80289893 missense unknown
IGL01939:Myo6 APN 9 80260818 missense probably damaging 1.00
IGL02123:Myo6 APN 9 80264272 splice site probably benign
IGL02271:Myo6 APN 9 80260831 missense probably benign 0.01
IGL02512:Myo6 APN 9 80292519 critical splice donor site probably null
IGL02716:Myo6 APN 9 80269694 missense probably damaging 1.00
IGL02888:Myo6 APN 9 80269731 splice site probably benign
IGL02890:Myo6 APN 9 80266174 missense probably damaging 1.00
IGL02951:Myo6 APN 9 80264234 missense possibly damaging 0.66
IGL02990:Myo6 APN 9 80276403 critical splice donor site probably null
IGL03060:Myo6 APN 9 80260877 missense probably benign 0.00
IGL03145:Myo6 APN 9 80300665 nonsense probably null
IGL03306:Myo6 APN 9 80246555 missense probably damaging 1.00
mayday_circler UTSW 9 80246451 nonsense probably null
torticollis UTSW 9 80288217 critical splice donor site probably null
truths UTSW 9 80270039 nonsense probably null
IGL03134:Myo6 UTSW 9 80292467 missense probably damaging 0.96
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0124:Myo6 UTSW 9 80307774 missense probably damaging 1.00
R0133:Myo6 UTSW 9 80273975 splice site probably benign
R0207:Myo6 UTSW 9 80288056 missense probably damaging 1.00
R0295:Myo6 UTSW 9 80283579 missense probably damaging 0.98
R0389:Myo6 UTSW 9 80292466 missense probably damaging 0.98
R0432:Myo6 UTSW 9 80273974 splice site probably benign
R0526:Myo6 UTSW 9 80283541 missense possibly damaging 0.61
R0791:Myo6 UTSW 9 80262374 splice site probably benign
R0885:Myo6 UTSW 9 80242221 missense probably damaging 1.00
R1082:Myo6 UTSW 9 80288021 missense probably damaging 1.00
R1113:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1184:Myo6 UTSW 9 80286382 nonsense probably null
R1308:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1498:Myo6 UTSW 9 80307679 missense probably damaging 1.00
R1609:Myo6 UTSW 9 80288217 critical splice donor site probably null
R1615:Myo6 UTSW 9 80307725 missense probably damaging 1.00
R1771:Myo6 UTSW 9 80285800 missense probably damaging 1.00
R1772:Myo6 UTSW 9 80270049 missense possibly damaging 0.95
R1789:Myo6 UTSW 9 80300572 missense probably damaging 1.00
R1962:Myo6 UTSW 9 80260835 missense probably damaging 1.00
R1978:Myo6 UTSW 9 80228925 missense probably damaging 0.99
R2011:Myo6 UTSW 9 80307722 missense probably damaging 0.99
R2092:Myo6 UTSW 9 80245682 missense probably damaging 1.00
R2098:Myo6 UTSW 9 80281526 missense probably damaging 1.00
R2206:Myo6 UTSW 9 80258455 missense probably benign 0.01
R2286:Myo6 UTSW 9 80266212 missense possibly damaging 0.82
R2429:Myo6 UTSW 9 80303301 critical splice donor site probably null
R2696:Myo6 UTSW 9 80260894 missense probably benign 0.00
R2897:Myo6 UTSW 9 80269611 splice site probably null
R2898:Myo6 UTSW 9 80269611 splice site probably null
R3881:Myo6 UTSW 9 80264256 missense probably damaging 1.00
R4424:Myo6 UTSW 9 80288038 missense probably benign 0.26
R4718:Myo6 UTSW 9 80246517 missense probably benign 0.01
R4893:Myo6 UTSW 9 80228877 missense probably damaging 1.00
R4936:Myo6 UTSW 9 80307681 missense probably damaging 1.00
R4992:Myo6 UTSW 9 80283510 missense possibly damaging 0.95
R5073:Myo6 UTSW 9 80288008 missense probably benign 0.00
R5101:Myo6 UTSW 9 80270039 nonsense probably null
R5137:Myo6 UTSW 9 80242249 missense probably damaging 1.00
R5200:Myo6 UTSW 9 80276374 nonsense probably null
R5510:Myo6 UTSW 9 80245660 missense probably damaging 1.00
R5579:Myo6 UTSW 9 80217720 missense probably damaging 0.99
R5693:Myo6 UTSW 9 80266180 missense probably damaging 1.00
R5701:Myo6 UTSW 9 80258527 missense probably damaging 1.00
R7151:Myo6 UTSW 9 80245136 missense unknown
R7399:Myo6 UTSW 9 80262291 missense unknown
R7492:Myo6 UTSW 9 80288046 nonsense probably null
R7651:Myo6 UTSW 9 80264266 critical splice donor site probably null
R7698:Myo6 UTSW 9 80217656 missense unknown
R7743:Myo6 UTSW 9 80276329 missense unknown
R7888:Myo6 UTSW 9 80296665 missense probably damaging 0.99
R8161:Myo6 UTSW 9 80217709 missense unknown
R8245:Myo6 UTSW 9 80254947 missense unknown
R8375:Myo6 UTSW 9 80254924 missense unknown
R8387:Myo6 UTSW 9 80276350 missense unknown
R8467:Myo6 UTSW 9 80228886 missense probably damaging 1.00
R8669:Myo6 UTSW 9 80266249 missense unknown
R8770:Myo6 UTSW 9 80264199 missense unknown
R8807:Myo6 UTSW 9 80300667 critical splice donor site probably null
Z1191:Myo6 UTSW 9 80242227 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGTTCCTCCTTGCAGAGATG -3'
(R):5'- GGTGATCACGTACATTATGGCATG -3'

Sequencing Primer
(F):5'- GTTCCTCCTTGCAGAGATGTAATATG -3'
(R):5'- CACGTACATTATGGCATGTTATCAAG -3'
Posted On2018-07-24