Incidental Mutation 'R6693:Fbxw27'
ID528176
Institutional Source Beutler Lab
Gene Symbol Fbxw27
Ensembl Gene ENSMUSG00000104614
Gene NameF-box and WD-40 domain protein 27
Synonyms1700124P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109766045-109790670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109788044 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 130 (I130V)
Ref Sequence ENSEMBL: ENSMUSP00000148376 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000197125
AA Change: I130V

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect unknown
Transcript: ENSMUST00000199430
AA Change: I100V
Predicted Effect probably benign
Transcript: ENSMUST00000212725
AA Change: I130V

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Fbxw27
AlleleSourceChrCoordTypePredicted EffectPPH Score
Limping_along UTSW 9 109772269 missense probably damaging 1.00
PIT4494001:Fbxw27 UTSW 9 109772110 missense probably benign 0.00
R4977:Fbxw27 UTSW 9 109772119 missense probably damaging 0.97
R5012:Fbxw27 UTSW 9 109773203 missense probably benign 0.00
R5325:Fbxw27 UTSW 9 109770093 missense probably damaging 1.00
R6172:Fbxw27 UTSW 9 109772269 missense probably damaging 1.00
R6295:Fbxw27 UTSW 9 109772086 missense possibly damaging 0.82
R6912:Fbxw27 UTSW 9 109788080 nonsense probably null
R7026:Fbxw27 UTSW 9 109788078 missense possibly damaging 0.81
R7099:Fbxw27 UTSW 9 109770155 missense probably damaging 0.98
R7147:Fbxw27 UTSW 9 109789323 critical splice donor site probably null
R7884:Fbxw27 UTSW 9 109789400 nonsense probably null
R8241:Fbxw27 UTSW 9 109773215 missense possibly damaging 0.63
Z1177:Fbxw27 UTSW 9 109772178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTGCACAGATGGCTTAG -3'
(R):5'- GGGAAATGAACCATACCTCCTTC -3'

Sequencing Primer
(F):5'- TCTTTGGCCAAAGCACATGG -3'
(R):5'- CCTTCAGGTTGAGTTGTCCC -3'
Posted On2018-07-24