Incidental Mutation 'R6693:Pax9'
ID528179
Institutional Source Beutler Lab
Gene Symbol Pax9
Ensembl Gene ENSMUSG00000001497
Gene Namepaired box 9
SynonymsPax-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location56691767-56712822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56709731 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 285 (S285T)
Ref Sequence ENSEMBL: ENSMUSP00000117928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001538] [ENSMUST00000044634] [ENSMUST00000110680] [ENSMUST00000153250] [ENSMUST00000217690]
Predicted Effect probably benign
Transcript: ENSMUST00000001538
AA Change: S285T

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000001538
Gene: ENSMUSG00000001497
AA Change: S285T

DomainStartEndE-ValueType
PAX 4 128 6.81e-90 SMART
low complexity region 265 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044634
SMART Domains Protein: ENSMUSP00000039289
Gene: ENSMUSG00000035472

DomainStartEndE-ValueType
Pfam:Mito_carr 10 104 2.3e-24 PFAM
Pfam:Mito_carr 107 200 1.3e-16 PFAM
Pfam:Mito_carr 202 298 3.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110680
SMART Domains Protein: ENSMUSP00000106308
Gene: ENSMUSG00000035472

DomainStartEndE-ValueType
Pfam:Mito_carr 28 111 4.7e-21 PFAM
Pfam:Mito_carr 114 207 7.7e-17 PFAM
Pfam:Mito_carr 209 305 2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152848
Predicted Effect probably benign
Transcript: ENSMUST00000153250
AA Change: S285T

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117928
Gene: ENSMUSG00000001497
AA Change: S285T

DomainStartEndE-ValueType
PAX 4 128 6.81e-90 SMART
low complexity region 265 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217690
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. Mice lacking this gene exhibit impaired development of organs, musculature and the skeleton, including absent and abnormally developed teeth, and neonatal lethality. Mutations in the human gene are associated with selective tooth agenesis-3. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous inactivation of this gene results in abnormal tooth development and absent teeth and may lead to lack of pharyngeal pouch derivatives, athymia, craniofacial and limb anomalies, a small tympanic ring, various defects of the skeleton and musculature, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Pax9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pax9 APN 12 56700075 missense probably benign
IGL02724:Pax9 APN 12 56709819 missense possibly damaging 0.76
R0008:Pax9 UTSW 12 56709743 missense probably benign
R0008:Pax9 UTSW 12 56709743 missense probably benign
R1836:Pax9 UTSW 12 56700054 missense probably benign 0.03
R1916:Pax9 UTSW 12 56697138 missense possibly damaging 0.60
R2907:Pax9 UTSW 12 56709744 missense probably benign 0.03
R3778:Pax9 UTSW 12 56696748 missense probably damaging 1.00
R4905:Pax9 UTSW 12 56696626 missense probably damaging 1.00
R6247:Pax9 UTSW 12 56709695 missense probably benign
R6469:Pax9 UTSW 12 56696863 missense probably damaging 1.00
R7343:Pax9 UTSW 12 56695862 start codon destroyed probably null 0.48
R7739:Pax9 UTSW 12 56700099 missense probably benign 0.00
R7807:Pax9 UTSW 12 56697065 missense possibly damaging 0.95
R8458:Pax9 UTSW 12 56696765 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AGGCTACCCTTAGGTCAAAGTAAG -3'
(R):5'- ATCAGAGTGCAGAAGCGGTC -3'

Sequencing Primer
(F):5'- AGGGCTGTTAACTCCCTCAG -3'
(R):5'- AGCGGTCACAGAATGGC -3'
Posted On2018-07-24