Incidental Mutation 'R6693:Rps6ka5'
List |< first << previous [record 27 of 36] next >> last >|
ID528180
Institutional Source Beutler Lab
Gene Symbol Rps6ka5
Ensembl Gene ENSMUSG00000021180
Gene Nameribosomal protein S6 kinase, polypeptide 5
Synonyms6330404E13Rik, MSK1, 3110005L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location100548439-100726983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100573829 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 545 (V545A)
Ref Sequence ENSEMBL: ENSMUSP00000042987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043599] [ENSMUST00000222731]
Predicted Effect probably benign
Transcript: ENSMUST00000043599
AA Change: V545A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042987
Gene: ENSMUSG00000021180
AA Change: V545A

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
S_TKc 48 317 1.08e-101 SMART
S_TK_X 318 378 2.45e-13 SMART
S_TKc 425 751 1.1e-75 SMART
low complexity region 812 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221246
Predicted Effect probably benign
Transcript: ENSMUST00000221356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221379
Predicted Effect probably benign
Transcript: ENSMUST00000222731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223531
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutant allele exhibit altered response to cocaine including decreased hyperlocomotor activity and sensitization at a lower dose. Mice homozygous for a kinase dead allele exhibit altered experience-dependent synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Rps6ka5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Rps6ka5 APN 12 100573898 missense probably benign
IGL01450:Rps6ka5 APN 12 100552991 splice site probably benign
IGL01586:Rps6ka5 APN 12 100570914 missense probably damaging 0.99
IGL01743:Rps6ka5 APN 12 100575633 critical splice donor site probably null
IGL02995:Rps6ka5 APN 12 100573999 intron probably benign
IGL03051:Rps6ka5 APN 12 100615991 splice site probably null
IGL03190:Rps6ka5 APN 12 100558648 splice site probably benign
chard UTSW 12 100616083 missense probably damaging 1.00
Ramp UTSW 12 100575705 missense possibly damaging 0.85
zwiebel UTSW 12 100678538 missense probably damaging 0.99
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0067:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R0212:Rps6ka5 UTSW 12 100553169 splice site probably null
R0761:Rps6ka5 UTSW 12 100570882 missense probably damaging 1.00
R0893:Rps6ka5 UTSW 12 100574438 missense possibly damaging 0.71
R1237:Rps6ka5 UTSW 12 100575705 missense possibly damaging 0.85
R1254:Rps6ka5 UTSW 12 100619529 missense probably damaging 1.00
R1447:Rps6ka5 UTSW 12 100577825 missense probably benign 0.02
R1611:Rps6ka5 UTSW 12 100570852 missense possibly damaging 0.77
R2086:Rps6ka5 UTSW 12 100619615 missense possibly damaging 0.67
R2129:Rps6ka5 UTSW 12 100678538 missense probably damaging 0.99
R2298:Rps6ka5 UTSW 12 100551454 missense probably damaging 0.99
R2432:Rps6ka5 UTSW 12 100554405 missense probably damaging 0.98
R4378:Rps6ka5 UTSW 12 100597937 missense probably damaging 1.00
R4394:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4461:Rps6ka5 UTSW 12 100570864 missense probably damaging 0.99
R4584:Rps6ka5 UTSW 12 100581318 missense probably damaging 1.00
R4672:Rps6ka5 UTSW 12 100654287 missense possibly damaging 0.93
R4706:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4706:Rps6ka5 UTSW 12 100597885 splice site probably null
R4707:Rps6ka5 UTSW 12 100597885 splice site probably null
R4966:Rps6ka5 UTSW 12 100553066 missense probably benign 0.01
R5059:Rps6ka5 UTSW 12 100554375 missense probably damaging 0.96
R5404:Rps6ka5 UTSW 12 100616093 missense probably damaging 1.00
R5660:Rps6ka5 UTSW 12 100619580 missense possibly damaging 0.95
R5678:Rps6ka5 UTSW 12 100724876 missense unknown
R5992:Rps6ka5 UTSW 12 100575250 missense possibly damaging 0.68
R6104:Rps6ka5 UTSW 12 100553148 missense possibly damaging 0.84
R6163:Rps6ka5 UTSW 12 100595920 critical splice acceptor site probably null
R6390:Rps6ka5 UTSW 12 100570992 missense probably damaging 0.99
R6599:Rps6ka5 UTSW 12 100597909 missense probably damaging 1.00
R6653:Rps6ka5 UTSW 12 100551536 missense probably damaging 1.00
R7009:Rps6ka5 UTSW 12 100619537 missense probably damaging 1.00
R7157:Rps6ka5 UTSW 12 100581420 missense probably damaging 1.00
R7196:Rps6ka5 UTSW 12 100595864 missense possibly damaging 0.77
R7510:Rps6ka5 UTSW 12 100616068 missense possibly damaging 0.56
R7565:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R7800:Rps6ka5 UTSW 12 100558565 missense probably damaging 0.97
R7843:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R8009:Rps6ka5 UTSW 12 100577789 missense probably damaging 0.97
R8057:Rps6ka5 UTSW 12 100573796 critical splice donor site probably null
R8292:Rps6ka5 UTSW 12 100678532 missense possibly damaging 0.83
R8324:Rps6ka5 UTSW 12 100558487 missense possibly damaging 0.92
R8428:Rps6ka5 UTSW 12 100575241 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGATTACTGATCCTGGTACAAG -3'
(R):5'- AGCAGAAAGACAGATGTTCCC -3'

Sequencing Primer
(F):5'- CTGATCCTGGTACAAGTCTCAAG -3'
(R):5'- CAGAAAGACAGATGTTCCCTTTCATC -3'
Posted On2018-07-24