Incidental Mutation 'R6693:Adgrg7'
ID528184
Institutional Source Beutler Lab
Gene Symbol Adgrg7
Ensembl Gene ENSMUSG00000022755
Gene Nameadhesion G protein-coupled receptor G7
SynonymsGpr128, 9130020O16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location56724609-56795855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56770224 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 195 (N195Y)
Ref Sequence ENSEMBL: ENSMUSP00000023437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023437]
Predicted Effect probably damaging
Transcript: ENSMUST00000023437
AA Change: N195Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023437
Gene: ENSMUSG00000022755
AA Change: N195Y

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
SCOP:d1edmb_ 52 76 1e-3 SMART
GPS 376 424 6.16e-8 SMART
Pfam:7tm_2 428 712 4.5e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight gain and increased frequency of peristalsis and slow wave potential in the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Adgrg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Adgrg7 APN 16 56747919 critical splice donor site probably null
IGL03122:Adgrg7 APN 16 56770362 splice site probably benign
R0632:Adgrg7 UTSW 16 56742589 missense possibly damaging 0.89
R0673:Adgrg7 UTSW 16 56773486 missense possibly damaging 0.48
R1690:Adgrg7 UTSW 16 56795630 missense probably damaging 0.99
R2009:Adgrg7 UTSW 16 56761873 missense probably benign 0.08
R2017:Adgrg7 UTSW 16 56732806 missense probably benign 0.02
R2132:Adgrg7 UTSW 16 56767918 missense probably damaging 1.00
R2153:Adgrg7 UTSW 16 56752428 missense possibly damaging 0.75
R2229:Adgrg7 UTSW 16 56752403 missense probably benign
R2436:Adgrg7 UTSW 16 56761945 missense possibly damaging 0.78
R2878:Adgrg7 UTSW 16 56750454 missense probably benign 0.14
R2981:Adgrg7 UTSW 16 56750406 critical splice donor site probably null
R4014:Adgrg7 UTSW 16 56742288 missense probably damaging 1.00
R4023:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4024:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4026:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4551:Adgrg7 UTSW 16 56748012 missense probably damaging 1.00
R4834:Adgrg7 UTSW 16 56732869 missense probably damaging 1.00
R5041:Adgrg7 UTSW 16 56730348 missense probably benign 0.21
R5145:Adgrg7 UTSW 16 56742319 missense probably benign 0.04
R5377:Adgrg7 UTSW 16 56730306 missense possibly damaging 0.68
R5549:Adgrg7 UTSW 16 56750427 missense probably damaging 1.00
R5915:Adgrg7 UTSW 16 56730385 splice site probably null
R5957:Adgrg7 UTSW 16 56773427 missense probably damaging 0.96
R6146:Adgrg7 UTSW 16 56773466 missense probably benign 0.21
R6198:Adgrg7 UTSW 16 56777193 missense possibly damaging 0.64
R6233:Adgrg7 UTSW 16 56778642 missense possibly damaging 0.52
R6337:Adgrg7 UTSW 16 56752425 missense probably damaging 0.96
R6633:Adgrg7 UTSW 16 56730286 missense probably benign 0.05
R6812:Adgrg7 UTSW 16 56795798 start gained probably benign
R6841:Adgrg7 UTSW 16 56750424 missense probably damaging 1.00
R6868:Adgrg7 UTSW 16 56773476 missense probably benign
R7076:Adgrg7 UTSW 16 56742406 missense probably damaging 1.00
R7146:Adgrg7 UTSW 16 56730242 missense probably damaging 1.00
R7232:Adgrg7 UTSW 16 56777152 splice site probably null
R7266:Adgrg7 UTSW 16 56770311 missense probably benign 0.00
R7376:Adgrg7 UTSW 16 56724979 missense probably damaging 1.00
R7390:Adgrg7 UTSW 16 56732844 missense probably damaging 0.98
R7401:Adgrg7 UTSW 16 56742418 missense probably benign 0.43
R7496:Adgrg7 UTSW 16 56732857 missense probably benign
R7540:Adgrg7 UTSW 16 56750429 missense probably damaging 1.00
R8147:Adgrg7 UTSW 16 56742513 missense probably damaging 1.00
R8354:Adgrg7 UTSW 16 56795682 start gained probably benign
R8372:Adgrg7 UTSW 16 56795751 start gained probably benign
R8393:Adgrg7 UTSW 16 56762114 missense probably damaging 1.00
R8454:Adgrg7 UTSW 16 56795682 start gained probably benign
R8723:Adgrg7 UTSW 16 56761919 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCAGTGGGAAAAGATGTGC -3'
(R):5'- CAGCTCATTCAACTGCAGTCATTTG -3'

Sequencing Primer
(F):5'- AAAGATGTGCCTAGCCCCTGATG -3'
(R):5'- GCAGTCATTTGCAAAATGTTTAGG -3'
Posted On2018-07-24